Have a language expert improve your writing

Run a free plagiarism check in 10 minutes, generate accurate citations for free.

  • Knowledge Base
  • Null and Alternative Hypotheses | Definitions & Examples

Null & Alternative Hypotheses | Definitions, Templates & Examples

Published on May 6, 2022 by Shaun Turney . Revised on June 22, 2023.

The null and alternative hypotheses are two competing claims that researchers weigh evidence for and against using a statistical test :

  • Null hypothesis ( H 0 ): There’s no effect in the population .
  • Alternative hypothesis ( H a or H 1 ) : There’s an effect in the population.

Table of contents

Answering your research question with hypotheses, what is a null hypothesis, what is an alternative hypothesis, similarities and differences between null and alternative hypotheses, how to write null and alternative hypotheses, other interesting articles, frequently asked questions.

The null and alternative hypotheses offer competing answers to your research question . When the research question asks “Does the independent variable affect the dependent variable?”:

  • The null hypothesis ( H 0 ) answers “No, there’s no effect in the population.”
  • The alternative hypothesis ( H a ) answers “Yes, there is an effect in the population.”

The null and alternative are always claims about the population. That’s because the goal of hypothesis testing is to make inferences about a population based on a sample . Often, we infer whether there’s an effect in the population by looking at differences between groups or relationships between variables in the sample. It’s critical for your research to write strong hypotheses .

You can use a statistical test to decide whether the evidence favors the null or alternative hypothesis. Each type of statistical test comes with a specific way of phrasing the null and alternative hypothesis. However, the hypotheses can also be phrased in a general way that applies to any test.

Receive feedback on language, structure, and formatting

Professional editors proofread and edit your paper by focusing on:

  • Academic style
  • Vague sentences
  • Style consistency

See an example

examples of non null hypothesis

The null hypothesis is the claim that there’s no effect in the population.

If the sample provides enough evidence against the claim that there’s no effect in the population ( p ≤ α), then we can reject the null hypothesis . Otherwise, we fail to reject the null hypothesis.

Although “fail to reject” may sound awkward, it’s the only wording that statisticians accept . Be careful not to say you “prove” or “accept” the null hypothesis.

Null hypotheses often include phrases such as “no effect,” “no difference,” or “no relationship.” When written in mathematical terms, they always include an equality (usually =, but sometimes ≥ or ≤).

You can never know with complete certainty whether there is an effect in the population. Some percentage of the time, your inference about the population will be incorrect. When you incorrectly reject the null hypothesis, it’s called a type I error . When you incorrectly fail to reject it, it’s a type II error.

Examples of null hypotheses

The table below gives examples of research questions and null hypotheses. There’s always more than one way to answer a research question, but these null hypotheses can help you get started.

( )
Does tooth flossing affect the number of cavities? Tooth flossing has on the number of cavities. test:

The mean number of cavities per person does not differ between the flossing group (µ ) and the non-flossing group (µ ) in the population; µ = µ .

Does the amount of text highlighted in the textbook affect exam scores? The amount of text highlighted in the textbook has on exam scores. :

There is no relationship between the amount of text highlighted and exam scores in the population; β = 0.

Does daily meditation decrease the incidence of depression? Daily meditation the incidence of depression.* test:

The proportion of people with depression in the daily-meditation group ( ) is greater than or equal to the no-meditation group ( ) in the population; ≥ .

*Note that some researchers prefer to always write the null hypothesis in terms of “no effect” and “=”. It would be fine to say that daily meditation has no effect on the incidence of depression and p 1 = p 2 .

The alternative hypothesis ( H a ) is the other answer to your research question . It claims that there’s an effect in the population.

Often, your alternative hypothesis is the same as your research hypothesis. In other words, it’s the claim that you expect or hope will be true.

The alternative hypothesis is the complement to the null hypothesis. Null and alternative hypotheses are exhaustive, meaning that together they cover every possible outcome. They are also mutually exclusive, meaning that only one can be true at a time.

Alternative hypotheses often include phrases such as “an effect,” “a difference,” or “a relationship.” When alternative hypotheses are written in mathematical terms, they always include an inequality (usually ≠, but sometimes < or >). As with null hypotheses, there are many acceptable ways to phrase an alternative hypothesis.

Examples of alternative hypotheses

The table below gives examples of research questions and alternative hypotheses to help you get started with formulating your own.

Does tooth flossing affect the number of cavities? Tooth flossing has an on the number of cavities. test:

The mean number of cavities per person differs between the flossing group (µ ) and the non-flossing group (µ ) in the population; µ ≠ µ .

Does the amount of text highlighted in a textbook affect exam scores? The amount of text highlighted in the textbook has an on exam scores. :

There is a relationship between the amount of text highlighted and exam scores in the population; β ≠ 0.

Does daily meditation decrease the incidence of depression? Daily meditation the incidence of depression. test:

The proportion of people with depression in the daily-meditation group ( ) is less than the no-meditation group ( ) in the population; < .

Null and alternative hypotheses are similar in some ways:

  • They’re both answers to the research question.
  • They both make claims about the population.
  • They’re both evaluated by statistical tests.

However, there are important differences between the two types of hypotheses, summarized in the following table.

A claim that there is in the population. A claim that there is in the population.

Equality symbol (=, ≥, or ≤) Inequality symbol (≠, <, or >)
Rejected Supported
Failed to reject Not supported

To help you write your hypotheses, you can use the template sentences below. If you know which statistical test you’re going to use, you can use the test-specific template sentences. Otherwise, you can use the general template sentences.

General template sentences

The only thing you need to know to use these general template sentences are your dependent and independent variables. To write your research question, null hypothesis, and alternative hypothesis, fill in the following sentences with your variables:

Does independent variable affect dependent variable ?

  • Null hypothesis ( H 0 ): Independent variable does not affect dependent variable.
  • Alternative hypothesis ( H a ): Independent variable affects dependent variable.

Test-specific template sentences

Once you know the statistical test you’ll be using, you can write your hypotheses in a more precise and mathematical way specific to the test you chose. The table below provides template sentences for common statistical tests.

( )
test 

with two groups

The mean dependent variable does not differ between group 1 (µ ) and group 2 (µ ) in the population; µ = µ . The mean dependent variable differs between group 1 (µ ) and group 2 (µ ) in the population; µ ≠ µ .
with three groups The mean dependent variable does not differ between group 1 (µ ), group 2 (µ ), and group 3 (µ ) in the population; µ = µ = µ . The mean dependent variable of group 1 (µ ), group 2 (µ ), and group 3 (µ ) are not all equal in the population.
There is no correlation between independent variable and dependent variable in the population; ρ = 0. There is a correlation between independent variable and dependent variable in the population; ρ ≠ 0.
There is no relationship between independent variable and dependent variable in the population; β = 0. There is a relationship between independent variable and dependent variable in the population; β ≠ 0.
Two-proportions test The dependent variable expressed as a proportion does not differ between group 1 ( ) and group 2 ( ) in the population; = . The dependent variable expressed as a proportion differs between group 1 ( ) and group 2 ( ) in the population; ≠ .

Note: The template sentences above assume that you’re performing one-tailed tests . One-tailed tests are appropriate for most studies.

If you want to know more about statistics , methodology , or research bias , make sure to check out some of our other articles with explanations and examples.

  • Normal distribution
  • Descriptive statistics
  • Measures of central tendency
  • Correlation coefficient

Methodology

  • Cluster sampling
  • Stratified sampling
  • Types of interviews
  • Cohort study
  • Thematic analysis

Research bias

  • Implicit bias
  • Cognitive bias
  • Survivorship bias
  • Availability heuristic
  • Nonresponse bias
  • Regression to the mean

Hypothesis testing is a formal procedure for investigating our ideas about the world using statistics. It is used by scientists to test specific predictions, called hypotheses , by calculating how likely it is that a pattern or relationship between variables could have arisen by chance.

Null and alternative hypotheses are used in statistical hypothesis testing . The null hypothesis of a test always predicts no effect or no relationship between variables, while the alternative hypothesis states your research prediction of an effect or relationship.

The null hypothesis is often abbreviated as H 0 . When the null hypothesis is written using mathematical symbols, it always includes an equality symbol (usually =, but sometimes ≥ or ≤).

The alternative hypothesis is often abbreviated as H a or H 1 . When the alternative hypothesis is written using mathematical symbols, it always includes an inequality symbol (usually ≠, but sometimes < or >).

A research hypothesis is your proposed answer to your research question. The research hypothesis usually includes an explanation (“ x affects y because …”).

A statistical hypothesis, on the other hand, is a mathematical statement about a population parameter. Statistical hypotheses always come in pairs: the null and alternative hypotheses . In a well-designed study , the statistical hypotheses correspond logically to the research hypothesis.

Cite this Scribbr article

If you want to cite this source, you can copy and paste the citation or click the “Cite this Scribbr article” button to automatically add the citation to our free Citation Generator.

Turney, S. (2023, June 22). Null & Alternative Hypotheses | Definitions, Templates & Examples. Scribbr. Retrieved August 23, 2024, from https://www.scribbr.com/statistics/null-and-alternative-hypotheses/

Is this article helpful?

Shaun Turney

Shaun Turney

Other students also liked, inferential statistics | an easy introduction & examples, hypothesis testing | a step-by-step guide with easy examples, type i & type ii errors | differences, examples, visualizations, what is your plagiarism score.

Have a thesis expert improve your writing

Check your thesis for plagiarism in 10 minutes, generate your apa citations for free.

  • Knowledge Base
  • Null and Alternative Hypotheses | Definitions & Examples

Null and Alternative Hypotheses | Definitions & Examples

Published on 5 October 2022 by Shaun Turney . Revised on 6 December 2022.

The null and alternative hypotheses are two competing claims that researchers weigh evidence for and against using a statistical test :

  • Null hypothesis (H 0 ): There’s no effect in the population .
  • Alternative hypothesis (H A ): There’s an effect in the population.

The effect is usually the effect of the independent variable on the dependent variable .

Table of contents

Answering your research question with hypotheses, what is a null hypothesis, what is an alternative hypothesis, differences between null and alternative hypotheses, how to write null and alternative hypotheses, frequently asked questions about null and alternative hypotheses.

The null and alternative hypotheses offer competing answers to your research question . When the research question asks “Does the independent variable affect the dependent variable?”, the null hypothesis (H 0 ) answers “No, there’s no effect in the population.” On the other hand, the alternative hypothesis (H A ) answers “Yes, there is an effect in the population.”

The null and alternative are always claims about the population. That’s because the goal of hypothesis testing is to make inferences about a population based on a sample . Often, we infer whether there’s an effect in the population by looking at differences between groups or relationships between variables in the sample.

You can use a statistical test to decide whether the evidence favors the null or alternative hypothesis. Each type of statistical test comes with a specific way of phrasing the null and alternative hypothesis. However, the hypotheses can also be phrased in a general way that applies to any test.

The null hypothesis is the claim that there’s no effect in the population.

If the sample provides enough evidence against the claim that there’s no effect in the population ( p ≤ α), then we can reject the null hypothesis . Otherwise, we fail to reject the null hypothesis.

Although “fail to reject” may sound awkward, it’s the only wording that statisticians accept. Be careful not to say you “prove” or “accept” the null hypothesis.

Null hypotheses often include phrases such as “no effect”, “no difference”, or “no relationship”. When written in mathematical terms, they always include an equality (usually =, but sometimes ≥ or ≤).

Examples of null hypotheses

The table below gives examples of research questions and null hypotheses. There’s always more than one way to answer a research question, but these null hypotheses can help you get started.

( )
Does tooth flossing affect the number of cavities? Tooth flossing has on the number of cavities. test:

The mean number of cavities per person does not differ between the flossing group (µ ) and the non-flossing group (µ ) in the population; µ = µ .

Does the amount of text highlighted in the textbook affect exam scores? The amount of text highlighted in the textbook has on exam scores. :

There is no relationship between the amount of text highlighted and exam scores in the population; β = 0.

Does daily meditation decrease the incidence of depression? Daily meditation the incidence of depression.* test:

The proportion of people with depression in the daily-meditation group ( ) is greater than or equal to the no-meditation group ( ) in the population; ≥ .

*Note that some researchers prefer to always write the null hypothesis in terms of “no effect” and “=”. It would be fine to say that daily meditation has no effect on the incidence of depression and p 1 = p 2 .

The alternative hypothesis (H A ) is the other answer to your research question . It claims that there’s an effect in the population.

Often, your alternative hypothesis is the same as your research hypothesis. In other words, it’s the claim that you expect or hope will be true.

The alternative hypothesis is the complement to the null hypothesis. Null and alternative hypotheses are exhaustive, meaning that together they cover every possible outcome. They are also mutually exclusive, meaning that only one can be true at a time.

Alternative hypotheses often include phrases such as “an effect”, “a difference”, or “a relationship”. When alternative hypotheses are written in mathematical terms, they always include an inequality (usually ≠, but sometimes > or <). As with null hypotheses, there are many acceptable ways to phrase an alternative hypothesis.

Examples of alternative hypotheses

The table below gives examples of research questions and alternative hypotheses to help you get started with formulating your own.

Does tooth flossing affect the number of cavities? Tooth flossing has an on the number of cavities. test:

The mean number of cavities per person differs between the flossing group (µ ) and the non-flossing group (µ ) in the population; µ ≠ µ .

Does the amount of text highlighted in a textbook affect exam scores? The amount of text highlighted in the textbook has an on exam scores. :

There is a relationship between the amount of text highlighted and exam scores in the population; β ≠ 0.

Does daily meditation decrease the incidence of depression? Daily meditation the incidence of depression. test:

The proportion of people with depression in the daily-meditation group ( ) is less than the no-meditation group ( ) in the population; < .

Null and alternative hypotheses are similar in some ways:

  • They’re both answers to the research question
  • They both make claims about the population
  • They’re both evaluated by statistical tests.

However, there are important differences between the two types of hypotheses, summarized in the following table.

A claim that there is in the population. A claim that there is in the population.

Equality symbol (=, ≥, or ≤) Inequality symbol (≠, <, or >)
Rejected Supported
Failed to reject Not supported

To help you write your hypotheses, you can use the template sentences below. If you know which statistical test you’re going to use, you can use the test-specific template sentences. Otherwise, you can use the general template sentences.

The only thing you need to know to use these general template sentences are your dependent and independent variables. To write your research question, null hypothesis, and alternative hypothesis, fill in the following sentences with your variables:

Does independent variable affect dependent variable ?

  • Null hypothesis (H 0 ): Independent variable does not affect dependent variable .
  • Alternative hypothesis (H A ): Independent variable affects dependent variable .

Test-specific

Once you know the statistical test you’ll be using, you can write your hypotheses in a more precise and mathematical way specific to the test you chose. The table below provides template sentences for common statistical tests.

( )
test 

with two groups

The mean dependent variable does not differ between group 1 (µ ) and group 2 (µ ) in the population; µ = µ . The mean dependent variable differs between group 1 (µ ) and group 2 (µ ) in the population; µ ≠ µ .
with three groups The mean dependent variable does not differ between group 1 (µ ), group 2 (µ ), and group 3 (µ ) in the population; µ = µ = µ . The mean dependent variable of group 1 (µ ), group 2 (µ ), and group 3 (µ ) are not all equal in the population.
There is no correlation between independent variable and dependent variable in the population; ρ = 0. There is a correlation between independent variable and dependent variable in the population; ρ ≠ 0.
There is no relationship between independent variable and dependent variable in the population; β = 0. There is a relationship between independent variable and dependent variable in the population; β ≠ 0.
Two-proportions test The dependent variable expressed as a proportion does not differ between group 1 ( ) and group 2 ( ) in the population; = . The dependent variable expressed as a proportion differs between group 1 ( ) and group 2 ( ) in the population; ≠ .

Note: The template sentences above assume that you’re performing one-tailed tests . One-tailed tests are appropriate for most studies.

The null hypothesis is often abbreviated as H 0 . When the null hypothesis is written using mathematical symbols, it always includes an equality symbol (usually =, but sometimes ≥ or ≤).

The alternative hypothesis is often abbreviated as H a or H 1 . When the alternative hypothesis is written using mathematical symbols, it always includes an inequality symbol (usually ≠, but sometimes < or >).

A research hypothesis is your proposed answer to your research question. The research hypothesis usually includes an explanation (‘ x affects y because …’).

A statistical hypothesis, on the other hand, is a mathematical statement about a population parameter. Statistical hypotheses always come in pairs: the null and alternative hypotheses. In a well-designed study , the statistical hypotheses correspond logically to the research hypothesis.

Cite this Scribbr article

If you want to cite this source, you can copy and paste the citation or click the ‘Cite this Scribbr article’ button to automatically add the citation to our free Reference Generator.

Turney, S. (2022, December 06). Null and Alternative Hypotheses | Definitions & Examples. Scribbr. Retrieved 21 August 2024, from https://www.scribbr.co.uk/stats/null-and-alternative-hypothesis/

Is this article helpful?

Shaun Turney

Shaun Turney

Other students also liked, levels of measurement: nominal, ordinal, interval, ratio, the standard normal distribution | calculator, examples & uses, types of variables in research | definitions & examples.

9.1 Null and Alternative Hypotheses

The actual test begins by considering two hypotheses . They are called the null hypothesis and the alternative hypothesis . These hypotheses contain opposing viewpoints.

H 0 , the — null hypothesis: a statement of no difference between sample means or proportions or no difference between a sample mean or proportion and a population mean or proportion. In other words, the difference equals 0.

H a —, the alternative hypothesis: a claim about the population that is contradictory to H 0 and what we conclude when we reject H 0 .

Since the null and alternative hypotheses are contradictory, you must examine evidence to decide if you have enough evidence to reject the null hypothesis or not. The evidence is in the form of sample data.

After you have determined which hypothesis the sample supports, you make a decision. There are two options for a decision. They are reject H 0 if the sample information favors the alternative hypothesis or do not reject H 0 or decline to reject H 0 if the sample information is insufficient to reject the null hypothesis.

Mathematical Symbols Used in H 0 and H a :

equal (=) not equal (≠) greater than (>) less than (<)
greater than or equal to (≥) less than (<)
less than or equal to (≤) more than (>)

H 0 always has a symbol with an equal in it. H a never has a symbol with an equal in it. The choice of symbol depends on the wording of the hypothesis test. However, be aware that many researchers use = in the null hypothesis, even with > or < as the symbol in the alternative hypothesis. This practice is acceptable because we only make the decision to reject or not reject the null hypothesis.

Example 9.1

H 0 : No more than 30 percent of the registered voters in Santa Clara County voted in the primary election. p ≤ 30 H a : More than 30 percent of the registered voters in Santa Clara County voted in the primary election. p > 30

A medical trial is conducted to test whether or not a new medicine reduces cholesterol by 25 percent. State the null and alternative hypotheses.

Example 9.2

We want to test whether the mean GPA of students in American colleges is different from 2.0 (out of 4.0). The null and alternative hypotheses are the following: H 0 : μ = 2.0 H a : μ ≠ 2.0

We want to test whether the mean height of eighth graders is 66 inches. State the null and alternative hypotheses. Fill in the correct symbol (=, ≠, ≥, <, ≤, >) for the null and alternative hypotheses.

  • H 0 : μ __ 66
  • H a : μ __ 66

Example 9.3

We want to test if college students take fewer than five years to graduate from college, on the average. The null and alternative hypotheses are the following: H 0 : μ ≥ 5 H a : μ < 5

We want to test if it takes fewer than 45 minutes to teach a lesson plan. State the null and alternative hypotheses. Fill in the correct symbol ( =, ≠, ≥, <, ≤, >) for the null and alternative hypotheses.

  • H 0 : μ __ 45
  • H a : μ __ 45

Example 9.4

An article on school standards stated that about half of all students in France, Germany, and Israel take advanced placement exams and a third of the students pass. The same article stated that 6.6 percent of U.S. students take advanced placement exams and 4.4 percent pass. Test if the percentage of U.S. students who take advanced placement exams is more than 6.6 percent. State the null and alternative hypotheses. H 0 : p ≤ 0.066 H a : p > 0.066

On a state driver’s test, about 40 percent pass the test on the first try. We want to test if more than 40 percent pass on the first try. Fill in the correct symbol (=, ≠, ≥, <, ≤, >) for the null and alternative hypotheses.

  • H 0 : p __ 0.40
  • H a : p __ 0.40

Collaborative Exercise

Bring to class a newspaper, some news magazines, and some internet articles. In groups, find articles from which your group can write null and alternative hypotheses. Discuss your hypotheses with the rest of the class.

This book may not be used in the training of large language models or otherwise be ingested into large language models or generative AI offerings without OpenStax's permission.

Want to cite, share, or modify this book? This book uses the Creative Commons Attribution License and you must attribute Texas Education Agency (TEA). The original material is available at: https://www.texasgateway.org/book/tea-statistics . Changes were made to the original material, including updates to art, structure, and other content updates.

Access for free at https://openstax.org/books/statistics/pages/1-introduction
  • Authors: Barbara Illowsky, Susan Dean
  • Publisher/website: OpenStax
  • Book title: Statistics
  • Publication date: Mar 27, 2020
  • Location: Houston, Texas
  • Book URL: https://openstax.org/books/statistics/pages/1-introduction
  • Section URL: https://openstax.org/books/statistics/pages/9-1-null-and-alternative-hypotheses

© Apr 16, 2024 Texas Education Agency (TEA). The OpenStax name, OpenStax logo, OpenStax book covers, OpenStax CNX name, and OpenStax CNX logo are not subject to the Creative Commons license and may not be reproduced without the prior and express written consent of Rice University.

User Preferences

Content preview.

Arcu felis bibendum ut tristique et egestas quis:

  • Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris
  • Duis aute irure dolor in reprehenderit in voluptate
  • Excepteur sint occaecat cupidatat non proident

Keyboard Shortcuts

10.1 - setting the hypotheses: examples.

A significance test examines whether the null hypothesis provides a plausible explanation of the data. The null hypothesis itself does not involve the data. It is a statement about a parameter (a numerical characteristic of the population). These population values might be proportions or means or differences between means or proportions or correlations or odds ratios or any other numerical summary of the population. The alternative hypothesis is typically the research hypothesis of interest. Here are some examples.

Example 10.2: Hypotheses with One Sample of One Categorical Variable Section  

About 10% of the human population is left-handed. Suppose a researcher at Penn State speculates that students in the College of Arts and Architecture are more likely to be left-handed than people found in the general population. We only have one sample since we will be comparing a population proportion based on a sample value to a known population value.

  • Research Question : Are artists more likely to be left-handed than people found in the general population?
  • Response Variable : Classification of the student as either right-handed or left-handed

State Null and Alternative Hypotheses

  • Null Hypothesis : Students in the College of Arts and Architecture are no more likely to be left-handed than people in the general population (population percent of left-handed students in the College of Art and Architecture = 10% or p = .10).
  • Alternative Hypothesis : Students in the College of Arts and Architecture are more likely to be left-handed than people in the general population (population percent of left-handed students in the College of Arts and Architecture > 10% or p > .10). This is a one-sided alternative hypothesis.

Example 10.3: Hypotheses with One Sample of One Measurement Variable Section  

 two Diphenhydramine pills

A generic brand of the anti-histamine Diphenhydramine markets a capsule with a 50 milligram dose. The manufacturer is worried that the machine that fills the capsules has come out of calibration and is no longer creating capsules with the appropriate dosage.

  • Research Question : Does the data suggest that the population mean dosage of this brand is different than 50 mg?
  • Response Variable : dosage of the active ingredient found by a chemical assay.
  • Null Hypothesis : On the average, the dosage sold under this brand is 50 mg (population mean dosage = 50 mg).
  • Alternative Hypothesis : On the average, the dosage sold under this brand is not 50 mg (population mean dosage ≠ 50 mg). This is a two-sided alternative hypothesis.

Example 10.4: Hypotheses with Two Samples of One Categorical Variable Section  

vegetarian airline meal

Many people are starting to prefer vegetarian meals on a regular basis. Specifically, a researcher believes that females are more likely than males to eat vegetarian meals on a regular basis.

  • Research Question : Does the data suggest that females are more likely than males to eat vegetarian meals on a regular basis?
  • Response Variable : Classification of whether or not a person eats vegetarian meals on a regular basis
  • Explanatory (Grouping) Variable: Sex
  • Null Hypothesis : There is no sex effect regarding those who eat vegetarian meals on a regular basis (population percent of females who eat vegetarian meals on a regular basis = population percent of males who eat vegetarian meals on a regular basis or p females = p males ).
  • Alternative Hypothesis : Females are more likely than males to eat vegetarian meals on a regular basis (population percent of females who eat vegetarian meals on a regular basis > population percent of males who eat vegetarian meals on a regular basis or p females > p males ). This is a one-sided alternative hypothesis.

Example 10.5: Hypotheses with Two Samples of One Measurement Variable Section  

low carb meal

Obesity is a major health problem today. Research is starting to show that people may be able to lose more weight on a low carbohydrate diet than on a low fat diet.

  • Research Question : Does the data suggest that, on the average, people are able to lose more weight on a low carbohydrate diet than on a low fat diet?
  • Response Variable : Weight loss (pounds)
  • Explanatory (Grouping) Variable : Type of diet
  • Null Hypothesis : There is no difference in the mean amount of weight loss when comparing a low carbohydrate diet with a low fat diet (population mean weight loss on a low carbohydrate diet = population mean weight loss on a low fat diet).
  • Alternative Hypothesis : The mean weight loss should be greater for those on a low carbohydrate diet when compared with those on a low fat diet (population mean weight loss on a low carbohydrate diet > population mean weight loss on a low fat diet). This is a one-sided alternative hypothesis.

Example 10.6: Hypotheses about the relationship between Two Categorical Variables Section  

  • Research Question : Do the odds of having a stroke increase if you inhale second hand smoke ? A case-control study of non-smoking stroke patients and controls of the same age and occupation are asked if someone in their household smokes.
  • Variables : There are two different categorical variables (Stroke patient vs control and whether the subject lives in the same household as a smoker). Living with a smoker (or not) is the natural explanatory variable and having a stroke (or not) is the natural response variable in this situation.
  • Null Hypothesis : There is no relationship between whether or not a person has a stroke and whether or not a person lives with a smoker (odds ratio between stroke and second-hand smoke situation is = 1).
  • Alternative Hypothesis : There is a relationship between whether or not a person has a stroke and whether or not a person lives with a smoker (odds ratio between stroke and second-hand smoke situation is > 1). This is a one-tailed alternative.

This research question might also be addressed like example 11.4 by making the hypotheses about comparing the proportion of stroke patients that live with smokers to the proportion of controls that live with smokers.

Example 10.7: Hypotheses about the relationship between Two Measurement Variables Section  

  • Research Question : A financial analyst believes there might be a positive association between the change in a stock's price and the amount of the stock purchased by non-management employees the previous day (stock trading by management being under "insider-trading" regulatory restrictions).
  • Variables : Daily price change information (the response variable) and previous day stock purchases by non-management employees (explanatory variable). These are two different measurement variables.
  • Null Hypothesis : The correlation between the daily stock price change (\$) and the daily stock purchases by non-management employees (\$) = 0.
  • Alternative Hypothesis : The correlation between the daily stock price change (\$) and the daily stock purchases by non-management employees (\$) > 0. This is a one-sided alternative hypothesis.

Example 10.8: Hypotheses about comparing the relationship between Two Measurement Variables in Two Samples Section  

Calculation of a person's approximate tip for their meal

  • Research Question : Is there a linear relationship between the amount of the bill (\$) at a restaurant and the tip (\$) that was left. Is the strength of this association different for family restaurants than for fine dining restaurants?
  • Variables : There are two different measurement variables. The size of the tip would depend on the size of the bill so the amount of the bill would be the explanatory variable and the size of the tip would be the response variable.
  • Null Hypothesis : The correlation between the amount of the bill (\$) at a restaurant and the tip (\$) that was left is the same at family restaurants as it is at fine dining restaurants.
  • Alternative Hypothesis : The correlation between the amount of the bill (\$) at a restaurant and the tip (\$) that was left is the difference at family restaurants then it is at fine dining restaurants. This is a two-sided alternative hypothesis.

Microbe Notes

Microbe Notes

Null hypothesis and alternative hypothesis with 9 differences

Null hypothesis and alternative hypothesis

Table of Contents

Interesting Science Videos

Null hypothesis definition

The null hypothesis is a general statement that states that there is no relationship between two phenomenons under consideration or that there is no association between two groups.

  • A hypothesis, in general, is an assumption that is yet to be proved with sufficient pieces of evidence. A null hypothesis thus is the hypothesis a researcher is trying to disprove.
  • A null hypothesis is a hypothesis capable of being objectively verified, tested, and even rejected.
  • If a study is to compare method A with method B about their relationship, and if the study is preceded on the assumption that both methods are equally good, then this assumption is termed as the null hypothesis.
  • The null hypothesis should always be a specific hypothesis, i.e., it should not state about or approximately a certain value.

Null hypothesis symbol

  • The symbol for the null hypothesis is H 0, and it is read as H-null, H-zero, or H-naught.
  • The null hypothesis is usually associated with just ‘equals to’ sign as a null hypothesis can either be accepted or rejected.

Null hypothesis purpose

  • The main purpose of a null hypothesis is to verify/ disprove the proposed statistical assumptions.
  • Some scientific null hypothesis help to advance a theory.
  • The null hypothesis is also used to verify the consistent results of multiple experiments. For e.g., the null hypothesis stating that there is no relation between some medication and age of the patients supports the general effectiveness conclusion, and allows recommendations.

Null hypothesis principle

  • The principle of the null hypothesis is collecting the data and determining the chances of the collected data in the study of a random sample, proving that the null hypothesis is true.
  • In situations or studies where the collected data doesn’t complete the expectation of the null hypothesis, it is concluded that the data doesn’t provide sufficient or reliable pieces of evidence to support the null hypothesis and thus, it is rejected.
  • The data collected is tested through some statistical tool which is designed to measure the extent of departure of the date from the null hypothesis.
  • The procedure decides whether the observed departure obtained from the statistical tool is larger than a defined value so that the probability of occurrence of a high departure value is very small under the null hypothesis.
  • However, some data might not contradict the null hypothesis which explains that only a weak conclusion can be made and that the data doesn’t provide strong pieces of evidence against the null hypothesis and the null hypothesis might or might not be true.
  • Under some other conditions, if the data collected is sufficient and is capable of providing enough evidence, the null hypothesis can be considered valid, indicating no relationship between the phenomena.

When to reject null hypothesis?

  • When the p-value of the data is less than the significant level of the test, the null hypothesis is rejected, indicating the test results are significant.
  • However, if the p-value is higher than the significant value, the null hypothesis is not rejected, and the results are considered not significant.
  • The level of significance is an important concept while hypothesis testing as it determines the percentage risk of rejecting the null hypothesis when H 0 might happen to be true.
  • In other words, if we take the level of significance at 5%, it means that the researcher is willing to take as much as a 5 percent risk of rejecting the null hypothesis when it (H 0 ) happens to be true.
  • The null hypothesis cannot be accepted because the lack of evidence only means that the relationship is not proven. It doesn’t prove that something doesn’t exist, but it just means that there are not enough shreds of evidence and the study might have missed it.

Null hypothesis examples

The following are some examples of null hypothesis:

  • If the hypothesis is that “the consumption of a particular medicine reduces the chances of heart arrest”, the null hypothesis will be “the consumption of the medicine doesn’t reduce the chances of heart arrest.”
  • If the hypothesis is that, “If random test scores are collected from men and women, does the score of one group differ from the other?” a possible null hypothesis will be that the mean test score of men is the same as that of the women.

H 0 : µ 1 = µ 2

H 0 = null hypothesis µ 1 = mean score of men µ 2 = mean score of women

Alternative hypothesis definition

An alternative hypothesis is a statement that describes that there is a relationship between two selected variables in a study.

  • An alternative hypothesis is usually used to state that a new theory is preferable to the old one (null hypothesis).
  • This hypothesis can be simply termed as an alternative to the null hypothesis.
  • The alternative hypothesis is the hypothesis that is to be proved that indicates that the results of a study are significant and that the sample observation is not results just from chance but from some non-random cause.
  • If a study is to compare method A with method B about their relationship and we assume that the method A is superior or the method B is inferior, then such a statement is termed as an alternative hypothesis.
  • Alternative hypotheses should be clearly stated, considering the nature of the research problem.

Alternative hypothesis symbol

  • The symbol of the alternative hypothesis is either H 1 or H a while using less than, greater than or not equal signs.

Alternative hypothesis purpose

  • An alternative hypothesis provides the researchers with some specific restatements and clarifications of the research problem.
  • An alternative hypothesis provides a direction to the study, which then can be utilized by the researcher to obtain the desired results.
  • Since the alternative hypothesis is selected before conducting the study, it allows the test to prove that the study is supported by evidence, separating it from the researchers’ desires and values.
  • An alternative hypothesis provides a chance of discovering new theories that can disprove an existing one that might not be supported by evidence.
  • The alternative hypothesis is important as they prove that a relationship exists between two variables selected and that the results of the study conducted are relevant and significant.

Alternative hypothesis principle

  • The principle behind the alternative hypothesis is similar to that of the null hypothesis.
  • The alternative hypothesis is based on the concept that when sufficient evidence is collected from the data of random sample, it provides a basis for proving the assumption made by the researcher regarding the study.
  • Like in the null hypothesis, the data collected from a random sample is passed through a statistical tool that measures the extent of departure of the data from the null hypothesis.
  • If the departure is small under the selected level of significance, the alternative hypothesis is accepted, and the null hypothesis is rejected.
  • If the data collected don’t have chances of being in the study of the random sample and are instead decided by the relationship within the sample of the study, an alternative hypothesis stands true.

Alternative hypothesis examples

The following are some examples of alternative hypothesis:

1. If a researcher is assuming that the bearing capacity of a bridge is more than 10 tons, then the hypothesis under this study will be:

Null hypothesis H 0 : µ= 10 tons Alternative hypothesis H a : µ>10 tons

2. Under another study that is trying to test whether there is a significant difference between the effectiveness of medicine against heart arrest, the alternative hypothesis will be that there is a relationship between the medicine and chances of heart arrest.

Null hypothesis vs Alternative hypothesis

The null hypothesis is a general statement that states that there is no relationship between two phenomenons under consideration or that there is no association between two groups. An alternative hypothesis is a statement that describes that there is a relationship between two selected variables in a study.
It is denoted by H . It is denoted by H or H .
It is followed by ‘equals to’ sign. It is followed by not equals to, ‘less than’ or ‘greater than’ sign.
The null hypothesis believes that the results are observed as a result of chance. The alternative hypothesis believes that the results are observed as a result of some real causes.
It is the hypothesis that the researcher tries to disprove. It is a hypothesis that the researcher tries to prove.
The result of the null hypothesis indicates no changes in opinions or actions. The result of an alternative hypothesis causes changes in opinions and actions.
If the null hypothesis is accepted, the results of the study become insignificant. If an alternative hypothesis is accepted, the results of the study become significant.
If the p-value is greater than the level of significance, the null hypothesis is accepted. If the p-value is smaller than the level of significance, an alternative hypothesis is accepted.
The null hypothesis allows the acceptance of correct existing theories and the consistency of multiple experiments. Alternative hypothesis are important as it establishes a relationship between two variables, resulting in new improved theories.
  • R. Kothari (1990) Research Methodology. Vishwa Prakasan. India.
  • https://www.statisticssolutions.com/null-hypothesis-and-alternative-hypothesis/
  • https://byjus.com/maths/null-hypothesis/
  • https://en.wikipedia.org/wiki/Null_hypothesis
  • https://keydifferences.com/difference-between-null-and-alternative-hypothesis.html
  • 5% – https://en.wikipedia.org/wiki/Null_hypothesis
  • 3% – https://keydifferences.com/difference-between-null-and-alternative-hypothesis.html
  • 2% – https://byjus.com/maths/null-hypothesis/
  • 1% – https://www.wisdomjobs.com/e-university/research-methodology-tutorial-355/procedure-for-hypothesis-testing-11525.html
  • 1% – https://www.thoughtco.com/definition-of-null-hypothesis-and-examples-605436
  • 1% – https://www.quora.com/What-are-the-different-types-of-hypothesis-and-what-are-some-examples-of-them
  • 1% – https://www.dummies.com/education/math/statistics/what-a-p-value-tells-you-about-statistical-data/
  • 1% – https://www.coursehero.com/file/p7jfbal5/These-are-hypotheses-capable-of-being-objectively-verified-and-tested-Thus-we/
  • 1% – https://support.minitab.com/en-us/minitab/18/help-and-how-to/modeling-statistics/anova/how-to/one-way-anova/interpret-the-results/all-statistics-and-graphs/methods/
  • 1% – https://stats.stackexchange.com/questions/105319/test-whether-there-is-a-significant-difference-between-two-groups
  • 1% – https://statisticsbyjim.com/hypothesis-testing/failing-reject-null-hypothesis/
  • 1% – https://quizlet.com/45299306/statistics-flash-cards/
  • <1% – https://www.thoughtco.com/significance-level-in-hypothesis-testing-1147177
  • <1% – https://www.thoughtco.com/null-hypothesis-vs-alternative-hypothesis-3126413
  • <1% – https://www.sagepub.com/sites/default/files/upm-binaries/40007_Chapter8.pdf
  • <1% – https://www.differencebetween.com/difference-between-hypothesis-and-vs-assumption/
  • <1% – https://www.coursehero.com/file/18076181/introduction-to-hypothesis/
  • <1% – https://statisticsbyjim.com/glossary/significance-level/
  • <1% – https://quizlet.com/164755799/research-methods-midterm-2-flash-cards/
  • <1% – https://online.stat.psu.edu/statprogram/reviews/statistical-concepts/hypothesis-testing/p-value-approach

About Author

Photo of author

Anupama Sapkota

Leave a Comment Cancel reply

Save my name, email, and website in this browser for the next time I comment.

This site uses Akismet to reduce spam. Learn how your comment data is processed .

Module 9: Hypothesis Testing With One Sample

Null and alternative hypotheses, learning outcomes.

  • Describe hypothesis testing in general and in practice

The actual test begins by considering two  hypotheses . They are called the null hypothesis and the alternative hypothesis . These hypotheses contain opposing viewpoints.

H 0 : The null hypothesis: It is a statement about the population that either is believed to be true or is used to put forth an argument unless it can be shown to be incorrect beyond a reasonable doubt.

H a : The alternative hypothesis : It is a claim about the population that is contradictory to H 0 and what we conclude when we reject H 0 .

Since the null and alternative hypotheses are contradictory, you must examine evidence to decide if you have enough evidence to reject the null hypothesis or not. The evidence is in the form of sample data.

After you have determined which hypothesis the sample supports, you make adecision. There are two options for a  decision . They are “reject H 0 ” if the sample information favors the alternative hypothesis or “do not reject H 0 ” or “decline to reject H 0 ” if the sample information is insufficient to reject the null hypothesis.

Mathematical Symbols Used in  H 0 and H a :

equal (=) not equal (≠)
greater than (>) less than (<)
greater than or equal to (≥) less than (<)
less than or equal to (≤) more than (>)

H 0 always has a symbol with an equal in it. H a never has a symbol with an equal in it. The choice of symbol depends on the wording of the hypothesis test. However, be aware that many researchers (including one of the co-authors in research work) use = in the null hypothesis, even with > or < as the symbol in the alternative hypothesis. This practice is acceptable because we only make the decision to reject or not reject the null hypothesis.

H 0 : No more than 30% of the registered voters in Santa Clara County voted in the primary election. p ≤ 30

H a : More than 30% of the registered voters in Santa Clara County voted in the primary election. p > 30

A medical trial is conducted to test whether or not a new medicine reduces cholesterol by 25%. State the null and alternative hypotheses.

H 0 : The drug reduces cholesterol by 25%. p = 0.25

H a : The drug does not reduce cholesterol by 25%. p ≠ 0.25

We want to test whether the mean GPA of students in American colleges is different from 2.0 (out of 4.0). The null and alternative hypotheses are:

H 0 : μ = 2.0

H a : μ ≠ 2.0

We want to test whether the mean height of eighth graders is 66 inches. State the null and alternative hypotheses. Fill in the correct symbol (=, ≠, ≥, <, ≤, >) for the null and alternative hypotheses. H 0 : μ __ 66 H a : μ __ 66

  • H 0 : μ = 66
  • H a : μ ≠ 66

We want to test if college students take less than five years to graduate from college, on the average. The null and alternative hypotheses are:

H 0 : μ ≥ 5

H a : μ < 5

We want to test if it takes fewer than 45 minutes to teach a lesson plan. State the null and alternative hypotheses. Fill in the correct symbol ( =, ≠, ≥, <, ≤, >) for the null and alternative hypotheses. H 0 : μ __ 45 H a : μ __ 45

  • H 0 : μ ≥ 45
  • H a : μ < 45

In an issue of U.S. News and World Report , an article on school standards stated that about half of all students in France, Germany, and Israel take advanced placement exams and a third pass. The same article stated that 6.6% of U.S. students take advanced placement exams and 4.4% pass. Test if the percentage of U.S. students who take advanced placement exams is more than 6.6%. State the null and alternative hypotheses.

H 0 : p ≤ 0.066

H a : p > 0.066

On a state driver’s test, about 40% pass the test on the first try. We want to test if more than 40% pass on the first try. Fill in the correct symbol (=, ≠, ≥, <, ≤, >) for the null and alternative hypotheses. H 0 : p __ 0.40 H a : p __ 0.40

  • H 0 : p = 0.40
  • H a : p > 0.40

Concept Review

In a  hypothesis test , sample data is evaluated in order to arrive at a decision about some type of claim. If certain conditions about the sample are satisfied, then the claim can be evaluated for a population. In a hypothesis test, we: Evaluate the null hypothesis , typically denoted with H 0 . The null is not rejected unless the hypothesis test shows otherwise. The null statement must always contain some form of equality (=, ≤ or ≥) Always write the alternative hypothesis , typically denoted with H a or H 1 , using less than, greater than, or not equals symbols, i.e., (≠, >, or <). If we reject the null hypothesis, then we can assume there is enough evidence to support the alternative hypothesis. Never state that a claim is proven true or false. Keep in mind the underlying fact that hypothesis testing is based on probability laws; therefore, we can talk only in terms of non-absolute certainties.

Formula Review

H 0 and H a are contradictory.

  • OpenStax, Statistics, Null and Alternative Hypotheses. Provided by : OpenStax. Located at : http://cnx.org/contents/[email protected]:58/Introductory_Statistics . License : CC BY: Attribution
  • Introductory Statistics . Authored by : Barbara Illowski, Susan Dean. Provided by : Open Stax. Located at : http://cnx.org/contents/[email protected] . License : CC BY: Attribution . License Terms : Download for free at http://cnx.org/contents/[email protected]
  • Simple hypothesis testing | Probability and Statistics | Khan Academy. Authored by : Khan Academy. Located at : https://youtu.be/5D1gV37bKXY . License : All Rights Reserved . License Terms : Standard YouTube License
  • Skip to secondary menu
  • Skip to main content
  • Skip to primary sidebar

Statistics By Jim

Making statistics intuitive

Null Hypothesis: Definition, Rejecting & Examples

By Jim Frost 6 Comments

What is a Null Hypothesis?

The null hypothesis in statistics states that there is no difference between groups or no relationship between variables. It is one of two mutually exclusive hypotheses about a population in a hypothesis test.

Photograph of Rodin's statue, The Thinker who is pondering the null hypothesis.

  • Null Hypothesis H 0 : No effect exists in the population.
  • Alternative Hypothesis H A : The effect exists in the population.

In every study or experiment, researchers assess an effect or relationship. This effect can be the effectiveness of a new drug, building material, or other intervention that has benefits. There is a benefit or connection that the researchers hope to identify. Unfortunately, no effect may exist. In statistics, we call this lack of an effect the null hypothesis. Researchers assume that this notion of no effect is correct until they have enough evidence to suggest otherwise, similar to how a trial presumes innocence.

In this context, the analysts don’t necessarily believe the null hypothesis is correct. In fact, they typically want to reject it because that leads to more exciting finds about an effect or relationship. The new vaccine works!

You can think of it as the default theory that requires sufficiently strong evidence to reject. Like a prosecutor, researchers must collect sufficient evidence to overturn the presumption of no effect. Investigators must work hard to set up a study and a data collection system to obtain evidence that can reject the null hypothesis.

Related post : What is an Effect in Statistics?

Null Hypothesis Examples

Null hypotheses start as research questions that the investigator rephrases as a statement indicating there is no effect or relationship.

Does the vaccine prevent infections? The vaccine does not affect the infection rate.
Does the new additive increase product strength? The additive does not affect mean product strength.
Does the exercise intervention increase bone mineral density? The intervention does not affect bone mineral density.
As screen time increases, does test performance decrease? There is no relationship between screen time and test performance.

After reading these examples, you might think they’re a bit boring and pointless. However, the key is to remember that the null hypothesis defines the condition that the researchers need to discredit before suggesting an effect exists.

Let’s see how you reject the null hypothesis and get to those more exciting findings!

When to Reject the Null Hypothesis

So, you want to reject the null hypothesis, but how and when can you do that? To start, you’ll need to perform a statistical test on your data. The following is an overview of performing a study that uses a hypothesis test.

The first step is to devise a research question and the appropriate null hypothesis. After that, the investigators need to formulate an experimental design and data collection procedures that will allow them to gather data that can answer the research question. Then they collect the data. For more information about designing a scientific study that uses statistics, read my post 5 Steps for Conducting Studies with Statistics .

After data collection is complete, statistics and hypothesis testing enter the picture. Hypothesis testing takes your sample data and evaluates how consistent they are with the null hypothesis. The p-value is a crucial part of the statistical results because it quantifies how strongly the sample data contradict the null hypothesis.

When the sample data provide sufficient evidence, you can reject the null hypothesis. In a hypothesis test, this process involves comparing the p-value to your significance level .

Rejecting the Null Hypothesis

Reject the null hypothesis when the p-value is less than or equal to your significance level. Your sample data favor the alternative hypothesis, which suggests that the effect exists in the population. For a mnemonic device, remember—when the p-value is low, the null must go!

When you can reject the null hypothesis, your results are statistically significant. Learn more about Statistical Significance: Definition & Meaning .

Failing to Reject the Null Hypothesis

Conversely, when the p-value is greater than your significance level, you fail to reject the null hypothesis. The sample data provides insufficient data to conclude that the effect exists in the population. When the p-value is high, the null must fly!

Note that failing to reject the null is not the same as proving it. For more information about the difference, read my post about Failing to Reject the Null .

That’s a very general look at the process. But I hope you can see how the path to more exciting findings depends on being able to rule out the less exciting null hypothesis that states there’s nothing to see here!

Let’s move on to learning how to write the null hypothesis for different types of effects, relationships, and tests.

Related posts : How Hypothesis Tests Work and Interpreting P-values

How to Write a Null Hypothesis

The null hypothesis varies by the type of statistic and hypothesis test. Remember that inferential statistics use samples to draw conclusions about populations. Consequently, when you write a null hypothesis, it must make a claim about the relevant population parameter . Further, that claim usually indicates that the effect does not exist in the population. Below are typical examples of writing a null hypothesis for various parameters and hypothesis tests.

Related posts : Descriptive vs. Inferential Statistics and Populations, Parameters, and Samples in Inferential Statistics

Group Means

T-tests and ANOVA assess the differences between group means. For these tests, the null hypothesis states that there is no difference between group means in the population. In other words, the experimental conditions that define the groups do not affect the mean outcome. Mu (µ) is the population parameter for the mean, and you’ll need to include it in the statement for this type of study.

For example, an experiment compares the mean bone density changes for a new osteoporosis medication. The control group does not receive the medicine, while the treatment group does. The null states that the mean bone density changes for the control and treatment groups are equal.

  • Null Hypothesis H 0 : Group means are equal in the population: µ 1 = µ 2 , or µ 1 – µ 2 = 0
  • Alternative Hypothesis H A : Group means are not equal in the population: µ 1 ≠ µ 2 , or µ 1 – µ 2 ≠ 0.

Group Proportions

Proportions tests assess the differences between group proportions. For these tests, the null hypothesis states that there is no difference between group proportions. Again, the experimental conditions did not affect the proportion of events in the groups. P is the population proportion parameter that you’ll need to include.

For example, a vaccine experiment compares the infection rate in the treatment group to the control group. The treatment group receives the vaccine, while the control group does not. The null states that the infection rates for the control and treatment groups are equal.

  • Null Hypothesis H 0 : Group proportions are equal in the population: p 1 = p 2 .
  • Alternative Hypothesis H A : Group proportions are not equal in the population: p 1 ≠ p 2 .

Correlation and Regression Coefficients

Some studies assess the relationship between two continuous variables rather than differences between groups.

In these studies, analysts often use either correlation or regression analysis . For these tests, the null states that there is no relationship between the variables. Specifically, it says that the correlation or regression coefficient is zero. As one variable increases, there is no tendency for the other variable to increase or decrease. Rho (ρ) is the population correlation parameter and beta (β) is the regression coefficient parameter.

For example, a study assesses the relationship between screen time and test performance. The null states that there is no correlation between this pair of variables. As screen time increases, test performance does not tend to increase or decrease.

  • Null Hypothesis H 0 : The correlation in the population is zero: ρ = 0.
  • Alternative Hypothesis H A : The correlation in the population is not zero: ρ ≠ 0.

For all these cases, the analysts define the hypotheses before the study. After collecting the data, they perform a hypothesis test to determine whether they can reject the null hypothesis.

The preceding examples are all for two-tailed hypothesis tests. To learn about one-tailed tests and how to write a null hypothesis for them, read my post One-Tailed vs. Two-Tailed Tests .

Related post : Understanding Correlation

Neyman, J; Pearson, E. S. (January 1, 1933).  On the Problem of the most Efficient Tests of Statistical Hypotheses .  Philosophical Transactions of the Royal Society A .  231  (694–706): 289–337.

Share this:

examples of non null hypothesis

Reader Interactions

' src=

January 11, 2024 at 2:57 pm

Thanks for the reply.

January 10, 2024 at 1:23 pm

Hi Jim, In your comment you state that equivalence test null and alternate hypotheses are reversed. For hypothesis tests of data fits to a probability distribution, the null hypothesis is that the probability distribution fits the data. Is this correct?

' src=

January 10, 2024 at 2:15 pm

Those two separate things, equivalence testing and normality tests. But, yes, you’re correct for both.

Hypotheses are switched for equivalence testing. You need to “work” (i.e., collect a large sample of good quality data) to be able to reject the null that the groups are different to be able to conclude they’re the same.

With typical hypothesis tests, if you have low quality data and a low sample size, you’ll fail to reject the null that they’re the same, concluding they’re equivalent. But that’s more a statement about the low quality and small sample size than anything to do with the groups being equal.

So, equivalence testing make you work to obtain a finding that the groups are the same (at least within some amount you define as a trivial difference).

For normality testing, and other distribution tests, the null states that the data follow the distribution (normal or whatever). If you reject the null, you have sufficient evidence to conclude that your sample data don’t follow the probability distribution. That’s a rare case where you hope to fail to reject the null. And it suffers from the problem I describe above where you might fail to reject the null simply because you have a small sample size. In that case, you’d conclude the data follow the probability distribution but it’s more that you don’t have enough data for the test to register the deviation. In this scenario, if you had a larger sample size, you’d reject the null and conclude it doesn’t follow that distribution.

I don’t know of any equivalence testing type approach for distribution fit tests where you’d need to work to show the data follow a distribution, although I haven’t looked for one either!

' src=

February 20, 2022 at 9:26 pm

Is a null hypothesis regularly (always) stated in the negative? “there is no” or “does not”

February 23, 2022 at 9:21 pm

Typically, the null hypothesis includes an equal sign. The null hypothesis states that the population parameter equals a particular value. That value is usually one that represents no effect. In the case of a one-sided hypothesis test, the null still contains an equal sign but it’s “greater than or equal to” or “less than or equal to.” If you wanted to translate the null hypothesis from its native mathematical expression, you could use the expression “there is no effect.” But the mathematical form more specifically states what it’s testing.

It’s the alternative hypothesis that typically contains does not equal.

There are some exceptions. For example, in an equivalence test where the researchers want to show that two things are equal, the null hypothesis states that they’re not equal.

In short, the null hypothesis states the condition that the researchers hope to reject. They need to work hard to set up an experiment and data collection that’ll gather enough evidence to be able to reject the null condition.

' src=

February 15, 2022 at 9:32 am

Dear sir I always read your notes on Research methods.. Kindly tell is there any available Book on all these..wonderfull Urgent

Comments and Questions Cancel reply

What is The Null Hypothesis & When Do You Reject The Null Hypothesis

Julia Simkus

Editor at Simply Psychology

BA (Hons) Psychology, Princeton University

Julia Simkus is a graduate of Princeton University with a Bachelor of Arts in Psychology. She is currently studying for a Master's Degree in Counseling for Mental Health and Wellness in September 2023. Julia's research has been published in peer reviewed journals.

Learn about our Editorial Process

Saul McLeod, PhD

Editor-in-Chief for Simply Psychology

BSc (Hons) Psychology, MRes, PhD, University of Manchester

Saul McLeod, PhD., is a qualified psychology teacher with over 18 years of experience in further and higher education. He has been published in peer-reviewed journals, including the Journal of Clinical Psychology.

Olivia Guy-Evans, MSc

Associate Editor for Simply Psychology

BSc (Hons) Psychology, MSc Psychology of Education

Olivia Guy-Evans is a writer and associate editor for Simply Psychology. She has previously worked in healthcare and educational sectors.

On This Page:

A null hypothesis is a statistical concept suggesting no significant difference or relationship between measured variables. It’s the default assumption unless empirical evidence proves otherwise.

The null hypothesis states no relationship exists between the two variables being studied (i.e., one variable does not affect the other).

The null hypothesis is the statement that a researcher or an investigator wants to disprove.

Testing the null hypothesis can tell you whether your results are due to the effects of manipulating ​ the dependent variable or due to random chance. 

How to Write a Null Hypothesis

Null hypotheses (H0) start as research questions that the investigator rephrases as statements indicating no effect or relationship between the independent and dependent variables.

It is a default position that your research aims to challenge or confirm.

For example, if studying the impact of exercise on weight loss, your null hypothesis might be:

There is no significant difference in weight loss between individuals who exercise daily and those who do not.

Examples of Null Hypotheses

Research QuestionNull Hypothesis
Do teenagers use cell phones more than adults?Teenagers and adults use cell phones the same amount.
Do tomato plants exhibit a higher rate of growth when planted in compost rather than in soil?Tomato plants show no difference in growth rates when planted in compost rather than soil.
Does daily meditation decrease the incidence of depression?Daily meditation does not decrease the incidence of depression.
Does daily exercise increase test performance?There is no relationship between daily exercise time and test performance.
Does the new vaccine prevent infections?The vaccine does not affect the infection rate.
Does flossing your teeth affect the number of cavities?Flossing your teeth has no effect on the number of cavities.

When Do We Reject The Null Hypothesis? 

We reject the null hypothesis when the data provide strong enough evidence to conclude that it is likely incorrect. This often occurs when the p-value (probability of observing the data given the null hypothesis is true) is below a predetermined significance level.

If the collected data does not meet the expectation of the null hypothesis, a researcher can conclude that the data lacks sufficient evidence to back up the null hypothesis, and thus the null hypothesis is rejected. 

Rejecting the null hypothesis means that a relationship does exist between a set of variables and the effect is statistically significant ( p > 0.05).

If the data collected from the random sample is not statistically significance , then the null hypothesis will be accepted, and the researchers can conclude that there is no relationship between the variables. 

You need to perform a statistical test on your data in order to evaluate how consistent it is with the null hypothesis. A p-value is one statistical measurement used to validate a hypothesis against observed data.

Calculating the p-value is a critical part of null-hypothesis significance testing because it quantifies how strongly the sample data contradicts the null hypothesis.

The level of statistical significance is often expressed as a  p  -value between 0 and 1. The smaller the p-value, the stronger the evidence that you should reject the null hypothesis.

Probability and statistical significance in ab testing. Statistical significance in a b experiments

Usually, a researcher uses a confidence level of 95% or 99% (p-value of 0.05 or 0.01) as general guidelines to decide if you should reject or keep the null.

When your p-value is less than or equal to your significance level, you reject the null hypothesis.

In other words, smaller p-values are taken as stronger evidence against the null hypothesis. Conversely, when the p-value is greater than your significance level, you fail to reject the null hypothesis.

In this case, the sample data provides insufficient data to conclude that the effect exists in the population.

Because you can never know with complete certainty whether there is an effect in the population, your inferences about a population will sometimes be incorrect.

When you incorrectly reject the null hypothesis, it’s called a type I error. When you incorrectly fail to reject it, it’s called a type II error.

Why Do We Never Accept The Null Hypothesis?

The reason we do not say “accept the null” is because we are always assuming the null hypothesis is true and then conducting a study to see if there is evidence against it. And, even if we don’t find evidence against it, a null hypothesis is not accepted.

A lack of evidence only means that you haven’t proven that something exists. It does not prove that something doesn’t exist. 

It is risky to conclude that the null hypothesis is true merely because we did not find evidence to reject it. It is always possible that researchers elsewhere have disproved the null hypothesis, so we cannot accept it as true, but instead, we state that we failed to reject the null. 

One can either reject the null hypothesis, or fail to reject it, but can never accept it.

Why Do We Use The Null Hypothesis?

We can never prove with 100% certainty that a hypothesis is true; We can only collect evidence that supports a theory. However, testing a hypothesis can set the stage for rejecting or accepting this hypothesis within a certain confidence level.

The null hypothesis is useful because it can tell us whether the results of our study are due to random chance or the manipulation of a variable (with a certain level of confidence).

A null hypothesis is rejected if the measured data is significantly unlikely to have occurred and a null hypothesis is accepted if the observed outcome is consistent with the position held by the null hypothesis.

Rejecting the null hypothesis sets the stage for further experimentation to see if a relationship between two variables exists. 

Hypothesis testing is a critical part of the scientific method as it helps decide whether the results of a research study support a particular theory about a given population. Hypothesis testing is a systematic way of backing up researchers’ predictions with statistical analysis.

It helps provide sufficient statistical evidence that either favors or rejects a certain hypothesis about the population parameter. 

Purpose of a Null Hypothesis 

  • The primary purpose of the null hypothesis is to disprove an assumption. 
  • Whether rejected or accepted, the null hypothesis can help further progress a theory in many scientific cases.
  • A null hypothesis can be used to ascertain how consistent the outcomes of multiple studies are.

Do you always need both a Null Hypothesis and an Alternative Hypothesis?

The null (H0) and alternative (Ha or H1) hypotheses are two competing claims that describe the effect of the independent variable on the dependent variable. They are mutually exclusive, which means that only one of the two hypotheses can be true. 

While the null hypothesis states that there is no effect in the population, an alternative hypothesis states that there is statistical significance between two variables. 

The goal of hypothesis testing is to make inferences about a population based on a sample. In order to undertake hypothesis testing, you must express your research hypothesis as a null and alternative hypothesis. Both hypotheses are required to cover every possible outcome of the study. 

What is the difference between a null hypothesis and an alternative hypothesis?

The alternative hypothesis is the complement to the null hypothesis. The null hypothesis states that there is no effect or no relationship between variables, while the alternative hypothesis claims that there is an effect or relationship in the population.

It is the claim that you expect or hope will be true. The null hypothesis and the alternative hypothesis are always mutually exclusive, meaning that only one can be true at a time.

What are some problems with the null hypothesis?

One major problem with the null hypothesis is that researchers typically will assume that accepting the null is a failure of the experiment. However, accepting or rejecting any hypothesis is a positive result. Even if the null is not refuted, the researchers will still learn something new.

Why can a null hypothesis not be accepted?

We can either reject or fail to reject a null hypothesis, but never accept it. If your test fails to detect an effect, this is not proof that the effect doesn’t exist. It just means that your sample did not have enough evidence to conclude that it exists.

We can’t accept a null hypothesis because a lack of evidence does not prove something that does not exist. Instead, we fail to reject it.

Failing to reject the null indicates that the sample did not provide sufficient enough evidence to conclude that an effect exists.

If the p-value is greater than the significance level, then you fail to reject the null hypothesis.

Is a null hypothesis directional or non-directional?

A hypothesis test can either contain an alternative directional hypothesis or a non-directional alternative hypothesis. A directional hypothesis is one that contains the less than (“<“) or greater than (“>”) sign.

A nondirectional hypothesis contains the not equal sign (“≠”).  However, a null hypothesis is neither directional nor non-directional.

A null hypothesis is a prediction that there will be no change, relationship, or difference between two variables.

The directional hypothesis or nondirectional hypothesis would then be considered alternative hypotheses to the null hypothesis.

Gill, J. (1999). The insignificance of null hypothesis significance testing.  Political research quarterly ,  52 (3), 647-674.

Krueger, J. (2001). Null hypothesis significance testing: On the survival of a flawed method.  American Psychologist ,  56 (1), 16.

Masson, M. E. (2011). A tutorial on a practical Bayesian alternative to null-hypothesis significance testing.  Behavior research methods ,  43 , 679-690.

Nickerson, R. S. (2000). Null hypothesis significance testing: a review of an old and continuing controversy.  Psychological methods ,  5 (2), 241.

Rozeboom, W. W. (1960). The fallacy of the null-hypothesis significance test.  Psychological bulletin ,  57 (5), 416.

Print Friendly, PDF & Email

Null Hypothesis Definition and Examples

PM Images / Getty Images

  • Chemical Laws
  • Periodic Table
  • Projects & Experiments
  • Scientific Method
  • Biochemistry
  • Physical Chemistry
  • Medical Chemistry
  • Chemistry In Everyday Life
  • Famous Chemists
  • Activities for Kids
  • Abbreviations & Acronyms
  • Weather & Climate
  • Ph.D., Biomedical Sciences, University of Tennessee at Knoxville
  • B.A., Physics and Mathematics, Hastings College

In a scientific experiment, the null hypothesis is the proposition that there is no effect or no relationship between phenomena or populations. If the null hypothesis is true, any observed difference in phenomena or populations would be due to sampling error (random chance) or experimental error. The null hypothesis is useful because it can be tested and found to be false, which then implies that there is a relationship between the observed data. It may be easier to think of it as a nullifiable hypothesis or one that the researcher seeks to nullify. The null hypothesis is also known as the H 0, or no-difference hypothesis.

The alternate hypothesis, H A or H 1 , proposes that observations are influenced by a non-random factor. In an experiment, the alternate hypothesis suggests that the experimental or independent variable has an effect on the dependent variable .

How to State a Null Hypothesis

There are two ways to state a null hypothesis. One is to state it as a declarative sentence, and the other is to present it as a mathematical statement.

For example, say a researcher suspects that exercise is correlated to weight loss, assuming diet remains unchanged. The average length of time to achieve a certain amount of weight loss is six weeks when a person works out five times a week. The researcher wants to test whether weight loss takes longer to occur if the number of workouts is reduced to three times a week.

The first step to writing the null hypothesis is to find the (alternate) hypothesis. In a word problem like this, you're looking for what you expect to be the outcome of the experiment. In this case, the hypothesis is "I expect weight loss to take longer than six weeks."

This can be written mathematically as: H 1 : μ > 6

In this example, μ is the average.

Now, the null hypothesis is what you expect if this hypothesis does not happen. In this case, if weight loss isn't achieved in greater than six weeks, then it must occur at a time equal to or less than six weeks. This can be written mathematically as:

H 0 : μ ≤ 6

The other way to state the null hypothesis is to make no assumption about the outcome of the experiment. In this case, the null hypothesis is simply that the treatment or change will have no effect on the outcome of the experiment. For this example, it would be that reducing the number of workouts would not affect the time needed to achieve weight loss:

H 0 : μ = 6

Null Hypothesis Examples

"Hyperactivity is unrelated to eating sugar " is an example of a null hypothesis. If the hypothesis is tested and found to be false, using statistics, then a connection between hyperactivity and sugar ingestion may be indicated. A significance test is the most common statistical test used to establish confidence in a null hypothesis.

Another example of a null hypothesis is "Plant growth rate is unaffected by the presence of cadmium in the soil ." A researcher could test the hypothesis by measuring the growth rate of plants grown in a medium lacking cadmium, compared with the growth rate of plants grown in mediums containing different amounts of cadmium. Disproving the null hypothesis would set the groundwork for further research into the effects of different concentrations of the element in soil.

Why Test a Null Hypothesis?

You may be wondering why you would want to test a hypothesis just to find it false. Why not just test an alternate hypothesis and find it true? The short answer is that it is part of the scientific method. In science, propositions are not explicitly "proven." Rather, science uses math to determine the probability that a statement is true or false. It turns out it's much easier to disprove a hypothesis than to positively prove one. Also, while the null hypothesis may be simply stated, there's a good chance the alternate hypothesis is incorrect.

For example, if your null hypothesis is that plant growth is unaffected by duration of sunlight, you could state the alternate hypothesis in several different ways. Some of these statements might be incorrect. You could say plants are harmed by more than 12 hours of sunlight or that plants need at least three hours of sunlight, etc. There are clear exceptions to those alternate hypotheses, so if you test the wrong plants, you could reach the wrong conclusion. The null hypothesis is a general statement that can be used to develop an alternate hypothesis, which may or may not be correct.

  • Kelvin Temperature Scale Definition
  • Independent Variable Definition and Examples
  • Theory Definition in Science
  • Hypothesis Definition (Science)
  • de Broglie Equation Definition
  • Law of Combining Volumes Definition
  • Chemical Definition
  • Pure Substance Definition in Chemistry
  • Acid Definition and Examples
  • Extensive Property Definition (Chemistry)
  • Radiation Definition and Examples
  • Valence Definition in Chemistry
  • Atomic Solid Definition
  • Weak Base Definition and Examples
  • Oxidation Definition and Example in Chemistry
  • Definition of Binary Compound
  • PRO Courses Guides New Tech Help Pro Expert Videos About wikiHow Pro Upgrade Sign In
  • EDIT Edit this Article
  • EXPLORE Tech Help Pro About Us Random Article Quizzes Request a New Article Community Dashboard This Or That Game Happiness Hub Popular Categories Arts and Entertainment Artwork Books Movies Computers and Electronics Computers Phone Skills Technology Hacks Health Men's Health Mental Health Women's Health Relationships Dating Love Relationship Issues Hobbies and Crafts Crafts Drawing Games Education & Communication Communication Skills Personal Development Studying Personal Care and Style Fashion Hair Care Personal Hygiene Youth Personal Care School Stuff Dating All Categories Arts and Entertainment Finance and Business Home and Garden Relationship Quizzes Cars & Other Vehicles Food and Entertaining Personal Care and Style Sports and Fitness Computers and Electronics Health Pets and Animals Travel Education & Communication Hobbies and Crafts Philosophy and Religion Work World Family Life Holidays and Traditions Relationships Youth
  • Browse Articles
  • Learn Something New
  • Quizzes Hot
  • Happiness Hub
  • This Or That Game
  • Train Your Brain
  • Explore More
  • Support wikiHow
  • About wikiHow
  • Log in / Sign up
  • Education and Communications
  • College University and Postgraduate
  • Academic Writing

Writing Null Hypotheses in Research and Statistics

Last Updated: January 17, 2024 Fact Checked

This article was co-authored by Joseph Quinones and by wikiHow staff writer, Jennifer Mueller, JD . Joseph Quinones is a High School Physics Teacher working at South Bronx Community Charter High School. Joseph specializes in astronomy and astrophysics and is interested in science education and science outreach, currently practicing ways to make physics accessible to more students with the goal of bringing more students of color into the STEM fields. He has experience working on Astrophysics research projects at the Museum of Natural History (AMNH). Joseph recieved his Bachelor's degree in Physics from Lehman College and his Masters in Physics Education from City College of New York (CCNY). He is also a member of a network called New York City Men Teach. There are 7 references cited in this article, which can be found at the bottom of the page. This article has been fact-checked, ensuring the accuracy of any cited facts and confirming the authority of its sources. This article has been viewed 28,792 times.

Are you working on a research project and struggling with how to write a null hypothesis? Well, you've come to the right place! Start by recognizing that the basic definition of "null" is "none" or "zero"—that's your biggest clue as to what a null hypothesis should say. Keep reading to learn everything you need to know about the null hypothesis, including how it relates to your research question and your alternative hypothesis as well as how to use it in different types of studies.

Things You Should Know

  • Write a research null hypothesis as a statement that the studied variables have no relationship to each other, or that there's no difference between 2 groups.

{\displaystyle \mu _{1}=\mu _{2}}

  • Adjust the format of your null hypothesis to match the statistical method you used to test it, such as using "mean" if you're comparing the mean between 2 groups.

What is a null hypothesis?

A null hypothesis states that there's no relationship between 2 variables.

  • Research hypothesis: States in plain language that there's no relationship between the 2 variables or there's no difference between the 2 groups being studied.
  • Statistical hypothesis: States the predicted outcome of statistical analysis through a mathematical equation related to the statistical method you're using.

Examples of Null Hypotheses

Step 1 Research question:

Null Hypothesis vs. Alternative Hypothesis

Step 1 Null hypotheses and alternative hypotheses are mutually exclusive.

  • For example, your alternative hypothesis could state a positive correlation between 2 variables while your null hypothesis states there's no relationship. If there's a negative correlation, then both hypotheses are false.

Step 2 Proving the null hypothesis false is a precursor to proving the alternative.

  • You need additional data or evidence to show that your alternative hypothesis is correct—proving the null hypothesis false is just the first step.
  • In smaller studies, sometimes it's enough to show that there's some relationship and your hypothesis could be correct—you can leave the additional proof as an open question for other researchers to tackle.

How do I test a null hypothesis?

Use statistical methods on collected data to test the null hypothesis.

  • Group means: Compare the mean of the variable in your sample with the mean of the variable in the general population. [6] X Research source
  • Group proportions: Compare the proportion of the variable in your sample with the proportion of the variable in the general population. [7] X Research source
  • Correlation: Correlation analysis looks at the relationship between 2 variables—specifically, whether they tend to happen together. [8] X Research source
  • Regression: Regression analysis reveals the correlation between 2 variables while also controlling for the effect of other, interrelated variables. [9] X Research source

Templates for Null Hypotheses

Step 1 Group means

  • Research null hypothesis: There is no difference in the mean [dependent variable] between [group 1] and [group 2].

{\displaystyle \mu _{1}+\mu _{2}=0}

  • Research null hypothesis: The proportion of [dependent variable] in [group 1] and [group 2] is the same.

{\displaystyle p_{1}=p_{2}}

  • Research null hypothesis: There is no correlation between [independent variable] and [dependent variable] in the population.

\rho =0

  • Research null hypothesis: There is no relationship between [independent variable] and [dependent variable] in the population.

{\displaystyle \beta =0}

Expert Q&A

Joseph Quinones

You Might Also Like

Write an Essay

Expert Interview

examples of non null hypothesis

Thanks for reading our article! If you’d like to learn more about physics, check out our in-depth interview with Joseph Quinones .

  • ↑ https://online.stat.psu.edu/stat100/lesson/10/10.1
  • ↑ https://online.stat.psu.edu/stat501/lesson/2/2.12
  • ↑ https://support.minitab.com/en-us/minitab/21/help-and-how-to/statistics/basic-statistics/supporting-topics/basics/null-and-alternative-hypotheses/
  • ↑ https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5635437/
  • ↑ https://online.stat.psu.edu/statprogram/reviews/statistical-concepts/hypothesis-testing
  • ↑ https://education.arcus.chop.edu/null-hypothesis-testing/
  • ↑ https://sphweb.bumc.bu.edu/otlt/mph-modules/bs/bs704_hypothesistest-means-proportions/bs704_hypothesistest-means-proportions_print.html

About This Article

Joseph Quinones

  • Send fan mail to authors

Reader Success Stories

Mogens Get

Dec 3, 2022

Did this article help you?

Do I Have a Dirty Mind Quiz

Featured Articles

Protect Yourself from Predators (for Kids)

Trending Articles

Reading Women’s Body Language: Signs & Signals That She’s Flirting

Watch Articles

Wear a Headband

  • Terms of Use
  • Privacy Policy
  • Do Not Sell or Share My Info
  • Not Selling Info

Get all the best how-tos!

Sign up for wikiHow's weekly email newsletter

Back Home

  • Science Notes Posts
  • Contact Science Notes
  • Todd Helmenstine Biography
  • Anne Helmenstine Biography
  • Free Printable Periodic Tables (PDF and PNG)
  • Periodic Table Wallpapers
  • Interactive Periodic Table
  • Periodic Table Posters
  • Science Experiments for Kids
  • How to Grow Crystals
  • Chemistry Projects
  • Fire and Flames Projects
  • Holiday Science
  • Chemistry Problems With Answers
  • Physics Problems
  • Unit Conversion Example Problems
  • Chemistry Worksheets
  • Biology Worksheets
  • Periodic Table Worksheets
  • Physical Science Worksheets
  • Science Lab Worksheets
  • My Amazon Books

Null Hypothesis Examples

Null Hypothesis Example

The null hypothesis (H 0 ) is the hypothesis that states there is no statistical difference between two sample sets. In other words, it assumes the independent variable does not have an effect on the dependent variable in a scientific experiment .

The null hypothesis is the most powerful type of hypothesis in the scientific method because it’s the easiest one to test with a high confidence level using statistics. If the null hypothesis is accepted, then it’s evidence any observed differences between two experiment groups are due to random chance. If the null hypothesis is rejected, then it’s strong evidence there is a true difference between test sets or that the independent variable affects the dependent variable.

  • The null hypothesis is a nullifiable hypothesis. A researcher seeks to reject it because this result strongly indicates observed differences are real and not just due to chance.
  • The null hypothesis may be accepted or rejected, but not proven. There is always a level of confidence in the outcome.

What Is the Null Hypothesis?

The null hypothesis is written as H 0 , which is read as H-zero, H-nought, or H-null. It is associated with another hypothesis, called the alternate or alternative hypothesis H A or H 1 . When the null hypothesis and alternate hypothesis are written mathematically, they cover all possible outcomes of an experiment.

An experimenter tests the null hypothesis with a statistical analysis called a significance test. The significance test determines the likelihood that the results of the test are not due to chance. Usually, a researcher uses a confidence level of 95% or 99% (p-value of 0.05 or 0.01). But, even if the confidence in the test is high, there is always a small chance the outcome is incorrect. This means you can’t prove a null hypothesis. It’s also a good reason why it’s important to repeat experiments.

Exact and Inexact Null Hypothesis

The most common type of null hypothesis assumes no difference between two samples or groups or no measurable effect of a treatment. This is the exact hypothesis . If you’re asked to state a null hypothesis for a science class, this is the one to write. It is the easiest type of hypothesis to test and is the only one accepted for certain types of analysis. Examples include:

There is no difference between two groups H 0 : μ 1  = μ 2 (where H 0  = the null hypothesis, μ 1  = the mean of population 1, and μ 2  = the mean of population 2)

Both groups have value of 100 (or any number or quality) H 0 : μ = 100

However, sometimes a researcher may test an inexact hypothesis . This type of hypothesis specifies ranges or intervals. Examples include:

Recovery time from a treatment is the same or worse than a placebo: H 0 : μ ≥ placebo time

There is a 5% or less difference between two groups: H 0 : 95 ≤ μ ≤ 105

An inexact hypothesis offers “directionality” about a phenomenon. For example, an exact hypothesis can indicate whether or not a treatment has an effect, while an inexact hypothesis can tell whether an effect is positive of negative. However, an inexact hypothesis may be harder to test and some scientists and statisticians disagree about whether it’s a true null hypothesis .

How to State the Null Hypothesis

To state the null hypothesis, first state what you expect the experiment to show. Then, rephrase the statement in a form that assumes there is no relationship between the variables or that a treatment has no effect.

Example: A researcher tests whether a new drug speeds recovery time from a certain disease. The average recovery time without treatment is 3 weeks.

  • State the goal of the experiment: “I hope the average recovery time with the new drug will be less than 3 weeks.”
  • Rephrase the hypothesis to assume the treatment has no effect: “If the drug doesn’t shorten recovery time, then the average time will be 3 weeks or longer.” Mathematically: H 0 : μ ≥ 3

This null hypothesis (inexact hypothesis) covers both the scenario in which the drug has no effect and the one in which the drugs makes the recovery time longer. The alternate hypothesis is that average recovery time will be less than three weeks:

H A : μ < 3

Of course, the researcher could test the no-effect hypothesis (exact null hypothesis): H 0 : μ = 3

The danger of testing this hypothesis is that rejecting it only implies the drug affected recovery time (not whether it made it better or worse). This is because the alternate hypothesis is:

H A : μ ≠ 3 (which includes μ <3 and μ >3)

Even though the no-effect null hypothesis yields less information, it’s used because it’s easier to test using statistics. Basically, testing whether something is unchanged/changed is easier than trying to quantify the nature of the change.

Remember, a researcher hopes to reject the null hypothesis because this supports the alternate hypothesis. Also, be sure the null and alternate hypothesis cover all outcomes. Finally, remember a simple true/false, equal/unequal, yes/no exact hypothesis is easier to test than a more complex inexact hypothesis.

Does chewing willow bark relieve pain?Pain relief is the same compared with a . (exact)
Pain relief after chewing willow bark is the same or worse versus taking a placebo. (inexact)
Pain relief is different compared with a placebo. (exact)
Pain relief is better compared to a placebo. (inexact)
Do cats care about the shape of their food?Cats show no food preference based on shape. (exact)Cat show a food preference based on shape. (exact)
Do teens use mobile devices more than adults?Teens and adults use mobile devices the same amount. (exact)
Teens use mobile devices less than or equal to adults. (inexact)
Teens and adults used mobile devices different amounts. (exact)
Teens use mobile devices more than adults. (inexact)
Does the color of light influence plant growth?The color of light has no effect on plant growth. (exact)The color of light affects plant growth. (exact)
  • Adèr, H. J.; Mellenbergh, G. J. & Hand, D. J. (2007).  Advising on Research Methods: A Consultant’s Companion . Huizen, The Netherlands: Johannes van Kessel Publishing. ISBN  978-90-79418-01-5 .
  • Cox, D. R. (2006).  Principles of Statistical Inference . Cambridge University Press. ISBN  978-0-521-68567-2 .
  • Everitt, Brian (1998).  The Cambridge Dictionary of Statistics . Cambridge, UK New York: Cambridge University Press. ISBN 978-0521593465.
  • Weiss, Neil A. (1999).  Introductory Statistics  (5th ed.). ISBN 9780201598773.

Related Posts

  • Math Article

Null Hypothesis

Class Registration Banner

In mathematics, Statistics deals with the study of research and surveys on the numerical data. For taking surveys, we have to define the hypothesis. Generally, there are two types of hypothesis. One is a null hypothesis, and another is an alternative hypothesis .

In probability and statistics, the null hypothesis is a comprehensive statement or default status that there is zero happening or nothing happening. For example, there is no connection among groups or no association between two measured events. It is generally assumed here that the hypothesis is true until any other proof has been brought into the light to deny the hypothesis. Let us learn more here with definition, symbol, principle, types and example, in this article.

Table of contents:

  • Comparison with Alternative Hypothesis

Null Hypothesis Definition

The null hypothesis is a kind of hypothesis which explains the population parameter whose purpose is to test the validity of the given experimental data. This hypothesis is either rejected or not rejected based on the viability of the given population or sample . In other words, the null hypothesis is a hypothesis in which the sample observations results from the chance. It is said to be a statement in which the surveyors wants to examine the data. It is denoted by H 0 .

Null Hypothesis Symbol

In statistics, the null hypothesis is usually denoted by letter H with subscript ‘0’ (zero), such that H 0 . It is pronounced as H-null or H-zero or H-nought. At the same time, the alternative hypothesis expresses the observations determined by the non-random cause. It is represented by H 1 or H a .

Null Hypothesis Principle

The principle followed for null hypothesis testing is, collecting the data and determining the chances of a given set of data during the study on some random sample, assuming that the null hypothesis is true. In case if the given data does not face the expected null hypothesis, then the outcome will be quite weaker, and they conclude by saying that the given set of data does not provide strong evidence against the null hypothesis because of insufficient evidence. Finally, the researchers tend to reject that.

Null Hypothesis Formula

Here, the hypothesis test formulas are given below for reference.

The formula for the null hypothesis is:

H 0 :  p = p 0

The formula for the alternative hypothesis is:

H a = p >p 0 , < p 0 ≠ p 0

The formula for the test static is:

Remember that,  p 0  is the null hypothesis and p – hat is the sample proportion.

Also, read:

Types of Null Hypothesis

There are different types of hypothesis. They are:

Simple Hypothesis

It completely specifies the population distribution. In this method, the sampling distribution is the function of the sample size.

Composite Hypothesis

The composite hypothesis is one that does not completely specify the population distribution.

Exact Hypothesis

Exact hypothesis defines the exact value of the parameter. For example μ= 50

Inexact Hypothesis

This type of hypothesis does not define the exact value of the parameter. But it denotes a specific range or interval. For example 45< μ <60

Null Hypothesis Rejection

Sometimes the null hypothesis is rejected too. If this hypothesis is rejected means, that research could be invalid. Many researchers will neglect this hypothesis as it is merely opposite to the alternate hypothesis. It is a better practice to create a hypothesis and test it. The goal of researchers is not to reject the hypothesis. But it is evident that a perfect statistical model is always associated with the failure to reject the null hypothesis.

How do you Find the Null Hypothesis?

The null hypothesis says there is no correlation between the measured event (the dependent variable) and the independent variable. We don’t have to believe that the null hypothesis is true to test it. On the contrast, you will possibly assume that there is a connection between a set of variables ( dependent and independent).

When is Null Hypothesis Rejected?

The null hypothesis is rejected using the P-value approach. If the P-value is less than or equal to the α, there should be a rejection of the null hypothesis in favour of the alternate hypothesis. In case, if P-value is greater than α, the null hypothesis is not rejected.

Null Hypothesis and Alternative Hypothesis

Now, let us discuss the difference between the null hypothesis and the alternative hypothesis.

1

The null hypothesis is a statement. There exists no relation between two variables

Alternative hypothesis a statement, there exists some relationship between two measured phenomenon

2

Denoted by H

Denoted by H

3

The observations of this hypothesis are the result of chance

The observations of this hypothesis are the result of real effect

4

The mathematical formulation of the null hypothesis is an equal sign

The mathematical formulation alternative hypothesis is an inequality sign such as greater than, less than, etc.

Null Hypothesis Examples

Here, some of the examples of the null hypothesis are given below. Go through the below ones to understand the concept of the null hypothesis in a better way.

If a medicine reduces the risk of cardiac stroke, then the null hypothesis should be “the medicine does not reduce the chance of cardiac stroke”. This testing can be performed by the administration of a drug to a certain group of people in a controlled way. If the survey shows that there is a significant change in the people, then the hypothesis is rejected.

Few more examples are:

1). Are there is 100% chance of getting affected by dengue?

Ans: There could be chances of getting affected by dengue but not 100%.

2). Do teenagers are using mobile phones more than grown-ups to access the internet?

Ans: Age has no limit on using mobile phones to access the internet.

3). Does having apple daily will not cause fever?

Ans: Having apple daily does not assure of not having fever, but increases the immunity to fight against such diseases.

4). Do the children more good in doing mathematical calculations than grown-ups?

Ans: Age has no effect on Mathematical skills.

In many common applications, the choice of the null hypothesis is not automated, but the testing and calculations may be automated. Also, the choice of the null hypothesis is completely based on previous experiences and inconsistent advice. The choice can be more complicated and based on the variety of applications and the diversity of the objectives. 

The main limitation for the choice of the null hypothesis is that the hypothesis suggested by the data is based on the reasoning which proves nothing. It means that if some hypothesis provides a summary of the data set, then there would be no value in the testing of the hypothesis on the particular set of data. 

Frequently Asked Questions on Null Hypothesis

What is meant by the null hypothesis.

In Statistics, a null hypothesis is a type of hypothesis which explains the population parameter whose purpose is to test the validity of the given experimental data.

What are the benefits of hypothesis testing?

Hypothesis testing is defined as a form of inferential statistics, which allows making conclusions from the entire population based on the sample representative.

When a null hypothesis is accepted and rejected?

The null hypothesis is either accepted or rejected in terms of the given data. If P-value is less than α, then the null hypothesis is rejected in favor of the alternative hypothesis, and if the P-value is greater than α, then the null hypothesis is accepted in favor of the alternative hypothesis.

Why is the null hypothesis important?

The importance of the null hypothesis is that it provides an approximate description of the phenomena of the given data. It allows the investigators to directly test the relational statement in a research study.

How to accept or reject the null hypothesis in the chi-square test?

If the result of the chi-square test is bigger than the critical value in the table, then the data does not fit the model, which represents the rejection of the null hypothesis.

Quiz Image

Put your understanding of this concept to test by answering a few MCQs. Click ‘Start Quiz’ to begin!

Select the correct answer and click on the “Finish” button Check your score and answers at the end of the quiz

Visit BYJU’S for all Maths related queries and study materials

Your result is as below

Request OTP on Voice Call

MATHS Related Links

examples of non null hypothesis

Register with BYJU'S & Download Free PDFs

Register with byju's & watch live videos.

  • School Guide
  • Mathematics
  • Number System and Arithmetic
  • Trigonometry
  • Probability
  • Mensuration
  • Maths Formulas
  • Integration Formulas
  • Differentiation Formulas
  • Trigonometry Formulas
  • Algebra Formulas
  • Mensuration Formula
  • Statistics Formulas
  • Trigonometric Table

Null Hypothesis

Null Hypothesis , often denoted as H 0, is a foundational concept in statistical hypothesis testing. It represents an assumption that no significant difference, effect, or relationship exists between variables within a population. It serves as a baseline assumption, positing no observed change or effect occurring. The null is t he truth or falsity of an idea in analysis.

In this article, we will discuss the null hypothesis in detail, along with some solved examples and questions on the null hypothesis.

Table of Content

What is Null Hypothesis?

Null hypothesis symbol, formula of null hypothesis, types of null hypothesis, null hypothesis examples, principle of null hypothesis, how do you find null hypothesis, null hypothesis in statistics, null hypothesis and alternative hypothesis, null hypothesis and alternative hypothesis examples, null hypothesis – practice problems.

Null Hypothesis in statistical analysis suggests the absence of statistical significance within a specific set of observed data. Hypothesis testing, using sample data, evaluates the validity of this hypothesis. Commonly denoted as H 0 or simply “null,” it plays an important role in quantitative analysis, examining theories related to markets, investment strategies, or economies to determine their validity.

Null Hypothesis Meaning

Null Hypothesis represents a default position, often suggesting no effect or difference, against which researchers compare their experimental results. The Null Hypothesis, often denoted as H 0 asserts a default assumption in statistical analysis. It posits no significant difference or effect, serving as a baseline for comparison in hypothesis testing.

The null Hypothesis is represented as H 0 , the Null Hypothesis symbolizes the absence of a measurable effect or difference in the variables under examination.

Certainly, a simple example would be asserting that the mean score of a group is equal to a specified value like stating that the average IQ of a population is 100.

The Null Hypothesis is typically formulated as a statement of equality or absence of a specific parameter in the population being studied. It provides a clear and testable prediction for comparison with the alternative hypothesis. The formulation of the Null Hypothesis typically follows a concise structure, stating the equality or absence of a specific parameter in the population.

Mean Comparison (Two-sample t-test)

H 0 : μ 1 = μ 2

This asserts that there is no significant difference between the means of two populations or groups.

Proportion Comparison

H 0 : p 1 − p 2 = 0

This suggests no significant difference in proportions between two populations or conditions.

Equality in Variance (F-test in ANOVA)

H 0 : σ 1 = σ 2

This states that there’s no significant difference in variances between groups or populations.

Independence (Chi-square Test of Independence):

H 0 : Variables are independent

This asserts that there’s no association or relationship between categorical variables.

Null Hypotheses vary including simple and composite forms, each tailored to the complexity of the research question. Understanding these types is pivotal for effective hypothesis testing.

Equality Null Hypothesis (Simple Null Hypothesis)

The Equality Null Hypothesis, also known as the Simple Null Hypothesis, is a fundamental concept in statistical hypothesis testing that assumes no difference, effect or relationship between groups, conditions or populations being compared.

Non-Inferiority Null Hypothesis

In some studies, the focus might be on demonstrating that a new treatment or method is not significantly worse than the standard or existing one.

Superiority Null Hypothesis

The concept of a superiority null hypothesis comes into play when a study aims to demonstrate that a new treatment, method, or intervention is significantly better than an existing or standard one.

Independence Null Hypothesis

In certain statistical tests, such as chi-square tests for independence, the null hypothesis assumes no association or independence between categorical variables.

Homogeneity Null Hypothesis

In tests like ANOVA (Analysis of Variance), the null hypothesis suggests that there’s no difference in population means across different groups.

  • Medicine: Null Hypothesis: “No significant difference exists in blood pressure levels between patients given the experimental drug versus those given a placebo.”
  • Education: Null Hypothesis: “There’s no significant variation in test scores between students using a new teaching method and those using traditional teaching.”
  • Economics: Null Hypothesis: “There’s no significant change in consumer spending pre- and post-implementation of a new taxation policy.”
  • Environmental Science: Null Hypothesis: “There’s no substantial difference in pollution levels before and after a water treatment plant’s establishment.”

The principle of the null hypothesis is a fundamental concept in statistical hypothesis testing. It involves making an assumption about the population parameter or the absence of an effect or relationship between variables.

In essence, the null hypothesis (H 0 ) proposes that there is no significant difference, effect, or relationship between variables. It serves as a starting point or a default assumption that there is no real change, no effect or no difference between groups or conditions.

The null hypothesis is usually formulated to be tested against an alternative hypothesis (H 1 or H [Tex]\alpha [/Tex] ) which suggests that there is an effect, difference or relationship present in the population.

Null Hypothesis Rejection

Rejecting the Null Hypothesis occurs when statistical evidence suggests a significant departure from the assumed baseline. It implies that there is enough evidence to support the alternative hypothesis, indicating a meaningful effect or difference. Null Hypothesis rejection occurs when statistical evidence suggests a deviation from the assumed baseline, prompting a reconsideration of the initial hypothesis.

Identifying the Null Hypothesis involves defining the status quotient, asserting no effect and formulating a statement suitable for statistical analysis.

When is Null Hypothesis Rejected?

The Null Hypothesis is rejected when statistical tests indicate a significant departure from the expected outcome, leading to the consideration of alternative hypotheses. It occurs when statistical evidence suggests a deviation from the assumed baseline, prompting a reconsideration of the initial hypothesis.

In statistical hypothesis testing, researchers begin by stating the null hypothesis, often based on theoretical considerations or previous research. The null hypothesis is then tested against an alternative hypothesis (Ha), which represents the researcher’s claim or the hypothesis they seek to support.

The process of hypothesis testing involves collecting sample data and using statistical methods to assess the likelihood of observing the data if the null hypothesis were true. This assessment is typically done by calculating a test statistic, which measures the difference between the observed data and what would be expected under the null hypothesis.

In the realm of hypothesis testing, the null hypothesis (H 0 ) and alternative hypothesis (H₁ or Ha) play critical roles. The null hypothesis generally assumes no difference, effect, or relationship between variables, suggesting that any observed change or effect is due to random chance. Its counterpart, the alternative hypothesis, asserts the presence of a significant difference, effect, or relationship between variables, challenging the null hypothesis. These hypotheses are formulated based on the research question and guide statistical analyses.

Difference Between Null Hypothesis and Alternative Hypothesis

The null hypothesis (H 0 ) serves as the baseline assumption in statistical testing, suggesting no significant effect, relationship, or difference within the data. It often proposes that any observed change or correlation is merely due to chance or random variation. Conversely, the alternative hypothesis (H 1 or Ha) contradicts the null hypothesis, positing the existence of a genuine effect, relationship or difference in the data. It represents the researcher’s intended focus, seeking to provide evidence against the null hypothesis and support for a specific outcome or theory. These hypotheses form the crux of hypothesis testing, guiding the assessment of data to draw conclusions about the population being studied.

Criteria

Null Hypothesis

Alternative Hypothesis

Definition

Assumes no effect or difference

Asserts a specific effect or difference

Symbol

H

H (or Ha)

Formulation

States equality or absence of parameter

States a specific value or relationship

Testing Outcome

Rejected if evidence of a significant effect

Accepted if evidence supports the hypothesis

Let’s envision a scenario where a researcher aims to examine the impact of a new medication on reducing blood pressure among patients. In this context:

Null Hypothesis (H 0 ): “The new medication does not produce a significant effect in reducing blood pressure levels among patients.”

Alternative Hypothesis (H 1 or Ha): “The new medication yields a significant effect in reducing blood pressure levels among patients.”

The null hypothesis implies that any observed alterations in blood pressure subsequent to the medication’s administration are a result of random fluctuations rather than a consequence of the medication itself. Conversely, the alternative hypothesis contends that the medication does indeed generate a meaningful alteration in blood pressure levels, distinct from what might naturally occur or by random chance.

People Also Read:

Mathematics Maths Formulas Probability and Statistics

Example 1: A researcher claims that the average time students spend on homework is 2 hours per night.

Null Hypothesis (H 0 ): The average time students spend on homework is equal to 2 hours per night. Data: A random sample of 30 students has an average homework time of 1.8 hours with a standard deviation of 0.5 hours. Test Statistic and Decision: Using a t-test, if the calculated t-statistic falls within the acceptance region, we fail to reject the null hypothesis. If it falls in the rejection region, we reject the null hypothesis. Conclusion: Based on the statistical analysis, we fail to reject the null hypothesis, suggesting that there is not enough evidence to dispute the claim of the average homework time being 2 hours per night.

Example 2: A company asserts that the error rate in its production process is less than 1%.

Null Hypothesis (H 0 ): The error rate in the production process is 1% or higher. Data: A sample of 500 products shows an error rate of 0.8%. Test Statistic and Decision: Using a z-test, if the calculated z-statistic falls within the acceptance region, we fail to reject the null hypothesis. If it falls in the rejection region, we reject the null hypothesis. Conclusion: The statistical analysis supports rejecting the null hypothesis, indicating that there is enough evidence to dispute the company’s claim of an error rate of 1% or higher.

Q1. A researcher claims that the average time spent by students on homework is less than 2 hours per day. Formulate the null hypothesis for this claim?

Q2. A manufacturing company states that their new machine produces widgets with a defect rate of less than 5%. Write the null hypothesis to test this claim?

Q3. An educational institute believes that their online course completion rate is at least 60%. Develop the null hypothesis to validate this assertion?

Q4. A restaurant claims that the waiting time for customers during peak hours is not more than 15 minutes. Formulate the null hypothesis for this claim?

Q5. A study suggests that the mean weight loss after following a specific diet plan for a month is more than 8 pounds. Construct the null hypothesis to evaluate this statement?

Summary – Null Hypothesis and Alternative Hypothesis

The null hypothesis (H 0 ) and alternative hypothesis (H a ) are fundamental concepts in statistical hypothesis testing. The null hypothesis represents the default assumption, stating that there is no significant effect, difference, or relationship between variables. It serves as the baseline against which the alternative hypothesis is tested. In contrast, the alternative hypothesis represents the researcher’s hypothesis or the claim to be tested, suggesting that there is a significant effect, difference, or relationship between variables. The relationship between the null and alternative hypotheses is such that they are complementary, and statistical tests are conducted to determine whether the evidence from the data is strong enough to reject the null hypothesis in favor of the alternative hypothesis. This decision is based on the strength of the evidence and the chosen level of significance. Ultimately, the choice between the null and alternative hypotheses depends on the specific research question and the direction of the effect being investigated.

FAQs on Null Hypothesis

What does null hypothesis stands for.

The null hypothesis, denoted as H 0 ​, is a fundamental concept in statistics used for hypothesis testing. It represents the statement that there is no effect or no difference, and it is the hypothesis that the researcher typically aims to provide evidence against.

How to Form a Null Hypothesis?

A null hypothesis is formed based on the assumption that there is no significant difference or effect between the groups being compared or no association between variables being tested. It often involves stating that there is no relationship, no change, or no effect in the population being studied.

When Do we reject the Null Hypothesis?

In statistical hypothesis testing, if the p-value (the probability of obtaining the observed results) is lower than the chosen significance level (commonly 0.05), we reject the null hypothesis. This suggests that the data provides enough evidence to refute the assumption made in the null hypothesis.

What is a Null Hypothesis in Research?

In research, the null hypothesis represents the default assumption or position that there is no significant difference or effect. Researchers often try to test this hypothesis by collecting data and performing statistical analyses to see if the observed results contradict the assumption.

What Are Alternative and Null Hypotheses?

The null hypothesis (H0) is the default assumption that there is no significant difference or effect. The alternative hypothesis (H1 or Ha) is the opposite, suggesting there is a significant difference, effect or relationship.

What Does it Mean to Reject the Null Hypothesis?

Rejecting the null hypothesis implies that there is enough evidence in the data to support the alternative hypothesis. In simpler terms, it suggests that there might be a significant difference, effect or relationship between the groups or variables being studied.

How to Find Null Hypothesis?

Formulating a null hypothesis often involves considering the research question and assuming that no difference or effect exists. It should be a statement that can be tested through data collection and statistical analysis, typically stating no relationship or no change between variables or groups.

How is Null Hypothesis denoted?

The null hypothesis is commonly symbolized as H 0 in statistical notation.

What is the Purpose of the Null hypothesis in Statistical Analysis?

The null hypothesis serves as a starting point for hypothesis testing, enabling researchers to assess if there’s enough evidence to reject it in favor of an alternative hypothesis.

What happens if we Reject the Null hypothesis?

Rejecting the null hypothesis implies that there is sufficient evidence to support an alternative hypothesis, suggesting a significant effect or relationship between variables.

What are Test for Null Hypothesis?

Various statistical tests, such as t-tests or chi-square tests, are employed to evaluate the validity of the Null Hypothesis in different scenarios.

Please Login to comment...

Similar reads.

  • Geeks Premier League
  • School Learning
  • Geeks Premier League 2023
  • Math-Concepts

Improve your Coding Skills with Practice

 alt=

What kind of Experience do you want to share?

helpful professor logo

15 Null Hypothesis Examples

15 Null Hypothesis Examples

Chris Drew (PhD)

Dr. Chris Drew is the founder of the Helpful Professor. He holds a PhD in education and has published over 20 articles in scholarly journals. He is the former editor of the Journal of Learning Development in Higher Education. [Image Descriptor: Photo of Chris]

Learn about our Editorial Process

null hypothesis example and definition, explained below

A null hypothesis is a general assertion or default position that there is no relationship or effect between two measured phenomena.

It’s a critical part of statistics, data analysis, and the scientific method . This concept forms the basis of testing statistical significance and allows researchers to be objective in their conclusions.

A null hypothesis helps to eliminate biases and ensures that the observed results are not due to chance. The rejection or failure to reject the null hypothesis helps in guiding the course of research.

chris

Null Hypothesis Definition

The null hypothesis, often denoted as H 0 , is the hypothesis in a statistical test which proposes no statistical significance exists in a set of observed data.

It hypothesizes that any kind of difference or importance you see in a data set is due to chance.

Null hypotheses are typically proposed to be negated or disproved by statistical tests, paving way for the acceptance of an alternate hypothesis.

Importantly, a null hypothesis cannot be proven true; it can only be supported or rejected with confidence.

Should evidence – via statistical analysis – contradict the null hypothesis, it is rejected in favor of an alternative hypothesis. In essence, the null hypothesis is a tool to challenge and disprove that there is no effect or relationship between variables.

Video Explanation

I like to show this video to my students which outlines a null hypothesis really clearly and engagingly, using real life studies by research students! The into explains it really well:

“There’s an idea in science called the null hypothesis and it works like this: when you’re setting out to prove a theory, your default answer should be “it’s not going to work” and you have to convince the world otherwise through clear results”

Here’s the full video:

Null Hypothesis Examples

  • Equality of Means: The null hypothesis posits that the average of group A does not differ from the average of group B. It suggests that any observed difference between the two group means is due to sampling or experimental error.
  • No Correlation: The null hypothesis states there is no correlation between the variable X and variable Y in the population. It means that any correlation seen in sample data occurred by chance.
  • Drug Effectiveness: The null hypothesis proposes that a new drug does not reduce the number of days to recover from a disease compared to a standard drug. Any observed difference is merely by chance and not due to the new drug.
  • Classroom Teaching Method: The null hypothesis states that a new teaching method does not result in improved test scores compared to the traditional teaching method. Any improvement in scores can be attributed to chance or other unrelated factors.
  • Smoking and Life Expectancy: The null hypothesis asserts that the average life expectancy of smokers is the same as that of non-smokers. Any perceived difference in life expectancy is due to random variation or other factors.
  • Brand Preference: The null hypothesis suggests that the proportion of consumers preferring Brand A is the same as those preferring Brand B. Any observed preference in the sample is due to random selection.
  • Vaccination Efficacy: The null hypothesis states that the efficacy of Vaccine A does not differ from that of Vaccine B. Any differences observed in a sample are due to chance or other confounding factors.
  • Diet and Weight Loss: The null hypothesis proposes that following a specific diet does not result in more weight loss than not following the diet. Any weight loss observed among dieters is considered random or influenced by other factors.
  • Exercise and Heart Rate: The null hypothesis states that regular exercise does not lower resting heart rate compared to no exercise. Any lower heart rates observed in exercisers could be due to chance or other unrelated factors.
  • Climate Change: The null hypothesis asserts that the average global temperature this decade is not higher than the previous decade. Any observed temperature increase can be attributed to random variation or unaccounted factors.
  • Gender Wage Gap: The null hypothesis posits that men and women earn the same average wage for the same job. Any observed wage disparity is due to chance or non-gender related factors.
  • Psychotherapy Effectiveness: The null hypothesis states that patients undergoing psychotherapy do not show more improvement than those not undergoing therapy. Any improvement in the
  • Energy Drink Consumption and Sleep: The null hypothesis proposes that consuming energy drinks does not affect the quantity of sleep. Any observed differences in sleep duration among energy drink consumers is due to random variation or other factors.
  • Organic Food and Health: The null hypothesis asserts that consuming organic food does not lead to better health outcomes compared to consuming non-organic food. Any health differences observed in consumers of organic food are considered random or attributed to other confounding factors.
  • Online Learning Effectiveness: The null hypothesis states that students learning online do not perform differently on exams than students learning in traditional classrooms. Any difference in performance can be attributed to chance or unrelated factors.

Null Hypothesis vs Alternative Hypothesis

An alternative hypothesis is the direct contrast to the null hypothesis. It posits that there is a statistically significant relationship or effect between the variables being observed.

If the null hypothesis is rejected based on the test data, the alternative hypothesis is accepted.

Importantly, while the null hypothesis is typically a statement of ‘no effect’ or ‘no difference,’ the alternative hypothesis states that there is an effect or difference.

Comprehension Checkpoint: How does the null hypothesis help to ensure that research is objective and unbiased?

A statement of no effect or no relationshipA statement that suggests there is an effect or relationship
H H or H
The average time to recover using Drug A is the same as with Drug BThe average time to recover using Drug A is less than with Drug B
No statistical significance between observed dataStatistical significance exists between observed data
The observed result is due to chanceThe observed result is due to the effect or relationship

Applications of the Null Hypothesis in Research

The null hypothesis plays a critical role in numerous research settings, promoting objectivity and ensuring findings aren’t due to random chance.

  • Clinical Trials: Null hypothesis is used extensively in medical and pharmaceutical research. For example, when testing a new drug’s effectiveness, the null hypothesis might state that the drug has no effect on the disease. If data contradicts this, the null hypothesis is rejected, suggesting the drug might be effective.
  • Business and Economics: Businesses use null hypotheses to make informed decisions. For instance, a company might use a null hypothesis to test if a new marketing strategy improves sales. If data suggests a significant increase in sales, the null hypothesis is rejected, and the new strategy may be implemented.
  • Psychological Research: Psychologists use null hypotheses to test theories about behavior. For instance, a null hypothesis might state there’s no link between stress and sleep quality. Rejecting this hypothesis based on collected data could help establish a correlation between the two variables.
  • Environmental Science: Null hypotheses are used to understand environmental changes. For instance, researchers might form a null hypothesis stating there is no significant difference in air quality before and after a policy change. If this hypothesis is rejected, it indicates the policy may have impacted air quality.
  • Education: Educators and researchers often use null hypotheses to improve teaching methods. For example, a null hypothesis might propose a new teaching technique doesn’t enhance student performance. If data contradicts this, the technique may be beneficial.

In all these areas, the null hypothesis helps minimize bias, enabling researchers to support their findings with statistically significant data. It forms the backbone of many scientific research methodologies , promoting a disciplined approach to uncovering new knowledge.

See More Hypothesis Examples Here

The null hypothesis is a cornerstone of statistical analysis and empirical research. It serves as a starting point for investigations, providing a baseline premise that the observed effects are due to chance. By understanding and applying the concept of the null hypothesis, researchers can test the validity of their assumptions, making their findings more robust and reliable. In essence, the null hypothesis ensures that the scientific exploration remains objective, systematic, and free from unintended bias.

Chris

  • Chris Drew (PhD) https://helpfulprofessor.com/author/chris-drew-phd/ 101 Hidden Talents Examples
  • Chris Drew (PhD) https://helpfulprofessor.com/author/chris-drew-phd/ 15 Green Flags in a Relationship
  • Chris Drew (PhD) https://helpfulprofessor.com/author/chris-drew-phd/ 15 Signs you're Burnt Out, Not Lazy
  • Chris Drew (PhD) https://helpfulprofessor.com/author/chris-drew-phd/ 15 Toxic Things Parents Say to their Children

Leave a Comment Cancel Reply

Your email address will not be published. Required fields are marked *

Examples

Null Hypothesis

Ai generator.

examples of non null hypothesis

Making a certain class or laboratory experiment would require a good null hypothesis . You will be given variables to be used in your experiment and then you would be able to identify the relationship between the two. Every beginning of the experiment report would indicate your hypotheses. It is proven useful for it can be tested to prove if the result is considered false.

What is a Null Hypothesis?

A null hypothesis is used during experiments to prove that there is no difference in the relationship between the two variables. Every type of experiment would require you to make a null hypothesis. From the word itself “null” means zero or no value. If you want to practice making a good experiment report , consider providing a good null hypothesis. Null hypothesis is designed to be rejected if the alternative hypothesis is proven to be exact.

Null Hypothesis Examples in Research

1. medical research.

  • Research Question: Does a new drug lower cholesterol levels more effectively than the current drug?
  • Null Hypothesis (H0): The new drug has no effect on cholesterol levels compared to the current drug.
  • Symbolic Form: H0: ?1 = ?2

2. Educational Research

  • Research Question: Does the use of interactive technology improve student test scores?
  • Null Hypothesis (H0): Interactive technology does not improve student test scores.

3. Business Research

  • Research Question: Does a new marketing strategy increase sales?
  • Null Hypothesis (H0): The new marketing strategy does not increase sales.

4. Psychological Research

  • Research Question: Does cognitive-behavioral therapy reduce symptoms of anxiety more than standard therapy?
  • Null Hypothesis (H0): Cognitive-behavioral therapy does not reduce anxiety symptoms more than standard therapy.

5. Environmental Research

  • Research Question: Does urbanization affect bird population diversity?
  • Null Hypothesis (H0): Urbanization has no effect on bird population diversity.
  • Symbolic Form: H0: ?urban = ?rural

6. Nutritional Research

  • Research Question: Does a low-carb diet lead to more weight loss than a low-fat diet?
  • Null Hypothesis (H0): A low-carb diet does not lead to more weight loss than a low-fat diet.

7. Economic Research

  • Research Question: Does increasing the minimum wage reduce poverty levels?
  • Null Hypothesis (H0): Increasing the minimum wage does not reduce poverty levels.
  • Symbolic Form: H0: ?before = ?after

8. Sociological Research

  • Research Question: Does social media usage affect teenagers’ self-esteem?
  • Null Hypothesis (H0): Social media usage does not affect teenagers’ self-esteem.
  • Symbolic Form: H0: ?users = ?non-users

9. Agricultural Research

  • Research Question: Does the use of a new fertilizer increase crop yield?
  • Null Hypothesis (H0): The new fertilizer does not increase crop yield.

10. Technological Research

  • Research Question: Does a new software algorithm improve processing speed?
  • Null Hypothesis (H0): The new software algorithm does not improve processing speed.
  • Symbolic Form: H0: ?new = ?old

Null Hypothesis Examples in Psychology

1. effectiveness of therapy.

  • Research Question: Does cognitive-behavioral therapy (CBT) reduce symptoms of depression more effectively than no treatment?
  • Null Hypothesis (H0): Cognitive-behavioral therapy does not reduce symptoms of depression more effectively than no treatment.
  • Symbolic Form: H0: ?CBT = ?control

2. Impact of Sleep on Memory

  • Research Question: Does sleep deprivation affect short-term memory performance?
  • Null Hypothesis (H0): Sleep deprivation has no effect on short-term memory performance.
  • Symbolic Form: H0: ?sleep_deprived = ?non_sleep_deprived

3. Influence of Color on Mood

  • Research Question: Does the color of a room affect individuals’ mood?
  • Null Hypothesis (H0): The color of a room does not affect individuals’ mood.
  • Symbolic Form: H0: ?color1 = ?color2 = ?color3

4. Social Media and Self-Esteem

  • Research Question: Does the frequency of social media use affect teenagers’ self-esteem?
  • Null Hypothesis (H0): The frequency of social media use does not affect teenagers’ self-esteem.
  • Symbolic Form: H0: ?high_use = ?low_use

5. Mindfulness and Stress Reduction

  • Research Question: Does mindfulness meditation reduce stress levels in college students?
  • Null Hypothesis (H0): Mindfulness meditation does not reduce stress levels in college students.
  • Symbolic Form: H0: ?mindfulness = ?control

6. Parenting Styles and Academic Performance

  • Research Question: Does authoritative parenting style affect children’s academic performance?
  • Null Hypothesis (H0): Authoritative parenting style does not affect children’s academic performance.
  • Symbolic Form: H0: ?authoritative = ?other_styles

7. Impact of Exercise on Anxiety

  • Research Question: Does regular exercise reduce anxiety levels in adults?
  • Null Hypothesis (H0): Regular exercise does not reduce anxiety levels in adults.
  • Symbolic Form: H0: ?exercise = ?no_exercise

8. Gender Differences in Risk-Taking Behavior

  • Research Question: Are there differences in risk-taking behavior between males and females?
  • Null Hypothesis (H0): There are no differences in risk-taking behavior between males and females.
  • Symbolic Form: H0: ?males = ?females

9. Impact of Music on Concentration

  • Research Question: Does listening to music while studying affect concentration levels?
  • Null Hypothesis (H0): Listening to music while studying does not affect concentration levels.
  • Symbolic Form: H0: ?music = ?no_music

10. Effect of Group Therapy on Social Skills

  • Research Question: Does group therapy improve social skills in individuals with social anxiety?
  • Null Hypothesis (H0): Group therapy does not improve social skills in individuals with social anxiety.
  • Symbolic Form: H0: ?group_therapy = ?no_therapy

Null Hypothesis Examples in Biology

1. effect of fertilizers on plant growth.

  • Research Question: Does a new fertilizer improve plant growth compared to no fertilizer?
  • Null Hypothesis (H0): The new fertilizer does not improve plant growth compared to no fertilizer.
  • Symbolic Form: H0: ?fertilizer = ?no_fertilizer

2. Antibiotic Effectiveness on Bacteria

  • Research Question: Does a new antibiotic reduce bacterial growth more effectively than an existing antibiotic?
  • Null Hypothesis (H0): The new antibiotic does not reduce bacterial growth more effectively than the existing antibiotic.
  • Symbolic Form: H0: ?new_antibiotic = ?existing_antibiotic

3. Impact of Temperature on Enzyme Activity

  • Research Question: Does temperature affect the activity of a specific enzyme?
  • Null Hypothesis (H0): Temperature does not affect the activity of the specific enzyme.
  • Symbolic Form: H0: Enzyme activity at temperature1 = Enzyme activity at temperature2

4. Genetic Influence on Trait Expression

  • Research Question: Does a specific gene affect the expression of a particular trait in a plant species?
  • Null Hypothesis (H0): The specific gene does not affect the expression of the particular trait in the plant species.
  • Symbolic Form: H0: Trait expression with gene = Trait expression without gene

5. Effect of Light Intensity on Photosynthesis

  • Research Question: Does light intensity affect the rate of photosynthesis in plants?
  • Null Hypothesis (H0): Light intensity does not affect the rate of photosynthesis in plants.
  • Symbolic Form: H0: Photosynthesis rate at light intensity1 = Photosynthesis rate at light intensity2

6. Impact of Diet on Animal Growth

  • Research Question: Does a high-protein diet affect the growth rate of animals?
  • Null Hypothesis (H0): A high-protein diet does not affect the growth rate of animals.
  • Symbolic Form: H0: Growth rate on high-protein diet = Growth rate on normal diet

7. Effect of Pollution on Aquatic Life

  • Research Question: Does water pollution affect the survival rate of fish in a lake?
  • Null Hypothesis (H0): Water pollution does not affect the survival rate of fish in a lake.
  • Symbolic Form: H0: Fish survival in polluted water = Fish survival in non-polluted water

8. Impact of Caffeine on Heart Rate in Daphnia

  • Research Question: Does caffeine affect the heart rate of Daphnia (water fleas)?
  • Null Hypothesis (H0): Caffeine does not affect the heart rate of Daphnia.
  • Symbolic Form: H0: Heart rate with caffeine = Heart rate without caffeine

9. Influence of Soil pH on Plant Germination

  • Research Question: Does soil pH affect the germination rate of seeds?
  • Null Hypothesis (H0): Soil pH does not affect the germination rate of seeds.
  • Symbolic Form: H0: Germination rate at pH1 = Germination rate at pH2

10. Effect of Salinity on Aquatic Plant Growth

  • Research Question: Does salinity affect the growth of aquatic plants?
  • Null Hypothesis (H0): Salinity does not affect the growth of aquatic plants.
  • Symbolic Form: H0: Plant growth in saline water = Plant growth in freshwater

Null Hypothesis Examples in Business

1. effect of marketing campaign on sales.

  • Research Question: Does a new marketing campaign increase product sales?
  • Null Hypothesis (H0): The new marketing campaign does not increase product sales.
  • Symbolic Form: H0: ?campaign = ?no_campaign

2. Impact of Training Programs on Employee Productivity

  • Research Question: Do training programs improve employee productivity?
  • Null Hypothesis (H0): Training programs do not improve employee productivity.
  • Symbolic Form: H0: ?trained = ?untrained

3. Influence of Price Changes on Demand

  • Research Question: Do price changes affect the demand for a product?
  • Null Hypothesis (H0): Price changes do not affect the demand for the product.
  • Symbolic Form: H0: ?price_change = ?no_price_change

4. Customer Satisfaction and Service Quality

  • Research Question: Does improving service quality increase customer satisfaction?
  • Null Hypothesis (H0): Improving service quality does not increase customer satisfaction.
  • Symbolic Form: H0: ?improved_service = ?standard_service

5. Effect of Employee Benefits on Retention Rates

  • Research Question: Do enhanced employee benefits reduce turnover rates?
  • Null Hypothesis (H0): Enhanced employee benefits do not reduce turnover rates.
  • Symbolic Form: H0: ?enhanced_benefits = ?standard_benefits

6. Impact of Social Media Presence on Brand Awareness

  • Research Question: Does an active social media presence increase brand awareness?
  • Null Hypothesis (H0): An active social media presence does not increase brand awareness.
  • Symbolic Form: H0: ?active_social_media = ?inactive_social_media

7. Influence of Store Layout on Customer Purchases

  • Research Question: Does store layout affect customer purchasing behavior?
  • Null Hypothesis (H0): Store layout does not affect customer purchasing behavior.
  • Symbolic Form: H0: ?layout1 = ?layout2

8. Online Advertising and Website Traffic

  • Research Question: Does online advertising increase website traffic?
  • Null Hypothesis (H0): Online advertising does not increase website traffic.
  • Symbolic Form: H0: ?ads = ?no_ads

9. Effect of Product Packaging on Sales

  • Research Question: Does new product packaging design increase sales?
  • Null Hypothesis (H0): The new product packaging design does not increase sales.
  • Symbolic Form: H0: ?new_packaging = ?old_packaging

10. Influence of Remote Work on Employee Performance

  • Research Question: Does remote work affect employee performance?
  • Null Hypothesis (H0): Remote work does not affect employee performance.
  • Symbolic Form: H0: ?remote_work = ?office_work

Null Hypothesis Examples in Statistics

1. comparing means.

  • Research Question: Is there a difference in average test scores between two groups of students?
  • Null Hypothesis (H0): There is no difference in the average test scores between the two groups.

2. Proportions

  • Research Question: Is the proportion of defective products the same in two different production lines?
  • Null Hypothesis (H0): The proportion of defective products is the same in both production lines.
  • Symbolic Form: H0: p1 = p2

3. Regression Analysis

  • Research Question: Is there a relationship between years of experience and salary?
  • Null Hypothesis (H0): There is no relationship between years of experience and salary.
  • Symbolic Form: H0: ? = 0 (where ? is the regression coefficient)

4. ANOVA (Analysis of Variance)

  • Research Question: Are the means of three or more groups equal?
  • Null Hypothesis (H0): The means of all groups are equal.
  • Symbolic Form: H0: ?1 = ?2 = ?3 = … = ?k

5. Chi-Square Test for Independence

  • Research Question: Are gender and voting preference independent?
  • Null Hypothesis (H0): Gender and voting preference are independent.
  • Symbolic Form: H0: There is no association between gender and voting preference.

6. Time Series Analysis

  • Research Question: Does a time series exhibit a trend over time?
  • Null Hypothesis (H0): There is no trend in the time series data over time.
  • Symbolic Form: H0: The time series has no significant trend component.

7. Hypothesis Testing for Variance

  • Research Question: Is the variance in test scores different between two classes?
  • Null Hypothesis (H0): The variances in test scores are equal between the two classes.
  • Symbolic Form: H0: ?1² = ?2²

8. Correlation Analysis

  • Research Question: Is there a correlation between two variables, such as height and weight?
  • Null Hypothesis (H0): There is no correlation between the two variables.
  • Symbolic Form: H0: ? = 0 (where ? is the correlation coefficient)

9. Two-Sample t-Test

  • Research Question: Do two samples have the same mean?
  • Null Hypothesis (H0): The two samples have the same mean.

10. One-Sample t-Test

  • Research Question: Does the sample mean differ from a known population mean?
  • Null Hypothesis (H0): The sample mean is equal to the population mean.
  • Symbolic Form: H0: ? = ?0

Real life Examples of Null Hypothesis

1. medical studies.

  • Research Question: Does a new medication lower blood pressure more effectively than the current medication?
  • Null Hypothesis (H0): The new medication does not lower blood pressure more effectively than the current medication.
  • Example: A clinical trial compares blood pressure readings between patients taking the new medication and those taking the current medication.

2. Education

  • Research Question: Does a new teaching method improve student test scores?
  • Null Hypothesis (H0): The new teaching method does not improve student test scores.
  • Example: An educational study compares test scores of students taught using the new method versus those taught using traditional methods.

3. Business

  • Research Question: Does a new advertising campaign increase product sales?
  • Null Hypothesis (H0): The new advertising campaign does not increase product sales.
  • Example: A company runs the new campaign and compares sales data before and after the campaign.

4. Public Health

  • Research Question: Does a smoking cessation program reduce the smoking rate in a community?
  • Null Hypothesis (H0): The smoking cessation program does not reduce the smoking rate in the community.
  • Example: Public health officials analyze smoking rates before and after implementing the program.

5. Environmental Science

  • Research Question: Does the introduction of a specific fish species affect the biodiversity of a lake?
  • Null Hypothesis (H0): The introduction of the specific fish species does not affect the biodiversity of the lake.
  • Example: Environmental scientists monitor biodiversity levels before and after introducing the fish species.

6. Economics

  • Research Question: Does raising the minimum wage reduce poverty levels?
  • Null Hypothesis (H0): Raising the minimum wage does not reduce poverty levels.
  • Example: Economists compare poverty rates in regions with and without recent minimum wage increases.

7. Psychology

  • Research Question: Does mindfulness meditation reduce stress levels among college students?
  • Null Hypothesis (H0): Mindfulness meditation does not reduce stress levels among college students.
  • Example: A study measures stress levels before and after a mindfulness meditation program in a group of students.

8. Agriculture

  • Example: Farmers apply the new fertilizer to one field and a standard fertilizer to another and compare the yields.

9. Technology

  • Research Question: Does a new software update improve the speed of a computer program?
  • Null Hypothesis (H0): The new software update does not improve the speed of the computer program.
  • Example: Software engineers measure the program’s speed before and after applying the update.

10. Marketing

  • Research Question: Does personalized email marketing increase customer engagement?
  • Null Hypothesis (H0): Personalized email marketing does not increase customer engagement.
  • Example: A company sends personalized emails to one group and generic emails to another, then compares engagement rates.

More Null Hypothesis Examples & Samples in PDF

1. null hypothesis significance test example.

Null Hypothesis Significance Test Example

2. Sample Null Hypothesis Example

Sample Null Hypothesis Example

3. Critical Assessment of Null Hypothesis Example

Critical Assessment of Null Hypothesis Example

4. Confidence Levels for Null Hypotheses Example

Confidence Levels for Null Hypotheses Example

5. Interpreting Failure to Reject A Null Hypothesis Example

Interpreting Failure to Reject A Null Hypothesis

6. Simple Null Hypothesis Example

Simple Null Hypothesis Example

7. Basic Neurology Null Hypothesis Example

Basic Neurology Null Hypothesis Example

8. Null Research Hypothesis in DOC

Null Research Hypothesis in DOC

Purpose of Null Hypothesis

The null hypothesis is a fundamental concept in statistics and scientific research . It serves several critical purposes in the process of hypothesis testing, guiding researchers in drawing meaningful conclusions from their data. Below are the primary purposes of the null hypothesis:

1. Baseline for Comparison

The null hypothesis provides a baseline or a default position that indicates no effect, no difference, or no relationship between variables. It is the statement that researchers aim to test against an alternative hypothesis. By starting with the assumption that there is no effect, researchers can objectively assess whether the data provide enough evidence to support the alternative hypothesis.

2. Eliminates Bias

By assuming no effect or no difference, the null hypothesis helps eliminate bias in research. Researchers approach their study without preconceived notions about the outcome, ensuring that the results are based on the data collected rather than personal beliefs or expectations.

3. Framework for Statistical Testing

The null hypothesis provides a structured framework for conducting statistical tests. It is essential for calculating p-values and test statistics, which determine whether the observed data are significantly different from what would be expected under the null hypothesis. This framework allows for a standardized approach to testing hypotheses across various fields of study.

4. Facilitates Decision Making

The null hypothesis facilitates decision-making in research by providing clear criteria for accepting or rejecting it. If the data provide sufficient evidence to reject the null hypothesis, researchers can conclude that there is a statistically significant effect or difference. This decision-making process is critical in advancing scientific knowledge and understanding.

5. Controls Type I and Type II Errors

The null hypothesis plays a crucial role in controlling Type I and Type II errors in hypothesis testing. A Type I error occurs when the null hypothesis is incorrectly rejected (a false positive), while a Type II error happens when the null hypothesis is incorrectly accepted (a false negative). By defining the null hypothesis, researchers can set significance levels (e.g., alpha level) to manage the risk of these errors.

When is the Null Hypothesis Rejected?

Rejecting the null hypothesis is a critical step in the process of hypothesis testing. The decision to reject the null hypothesis is based on statistical evidence derived from the data collected in a study. Below are the key factors that determine when the null hypothesis is rejected:

The p-value is a measure of the probability that the observed data (or something more extreme) would occur if the null hypothesis were true. The null hypothesis is rejected if the p-value is less than or equal to the predetermined significance level (?).

  • Significance Level (?): This is the threshold set by the researcher, commonly 0.05 (5%). If the p-value ? 0.05, the null hypothesis is rejected.
  • If a p-value of 0.03 is obtained and the significance level is 0.05, the null hypothesis is rejected.

2. Test Statistic

The test statistic is a standardized value calculated from sample data during a hypothesis test. It measures the degree to which the sample data differ from the null hypothesis. The decision to reject the null hypothesis depends on whether the test statistic falls within the critical region.

  • Critical Region: This is determined by the significance level and the distribution of the test statistic (e.g., Z-distribution, t-distribution).
  • In a two-tailed test with ? = 0.05, the critical region for a Z-test might be Z < -1.96 or Z > 1.96. If the test statistic is 2.10, the null hypothesis is rejected.

3. Confidence Intervals

Confidence intervals provide a range of values that are likely to contain the population parameter. If the confidence interval does not include the value specified by the null hypothesis, the null hypothesis is rejected.

  • If a 95% confidence interval for the mean difference between two groups is (2.5, 5.0) and the null hypothesis states that the mean difference is 0, the null hypothesis is rejected.

4. Effect Size

Effect size measures the magnitude of the difference between groups or the strength of a relationship between variables. While not a direct criterion for rejecting the null hypothesis, a substantial effect size can support the decision to reject the null hypothesis when combined with a significant p-value.

Null Hypothesis vs. Alternative Hypothesis

Null Hypothesis vs. Alternative Hypothesis

A statement that there is no effect or difference.A statement that there is an effect or difference.
Serves as a baseline or default position.Represents the outcome the researcher aims to support.
Assumes no relationship or effect.Assumes a relationship or effect exists.
“The new drug has no effect on blood pressure.”“The new drug lowers blood pressure.”
Retained if the p-value is greater than the significance level (?).Accepted if the p-value is less than or equal to the significance level (?).
Falls outside the critical region, indicating no significant effect.Falls within the critical region, indicating a significant effect.
Denoted by H0.Denoted by H1 or Ha.
Focuses on the absence of a significant effect or relationship.Focuses on the presence of a significant effect or relationship.
Incorrectly rejecting a true null hypothesis (false positive).N/A
N/AIncorrectly accepting a false null hypothesis (false negative).

How to Write a Null Hypothesis

Writing a null hypothesis is a crucial step in designing a scientific study or experiment. The null hypothesis (H0) serves as a starting point for statistical testing and represents a statement of no effect or no difference. Here’s a step-by-step guide on how to write a null hypothesis:

1. Identify the Research Question

Start by clearly defining the research question you want to investigate. Understand what you are testing and what you expect to find.

  • Example Research Question: Does a new medication reduce blood pressure more effectively than an existing medication?

2. Determine the Variables

Identify the independent and dependent variables in your study.

  • Independent Variable: The variable that is manipulated or categorized (e.g., type of medication).
  • Dependent Variable: The variable that is measured or observed (e.g., blood pressure).

3. State the Null Hypothesis Clearly

The null hypothesis should assert that there is no effect, no difference, or no relationship between the variables. It is usually written as a statement of equality or no change.

  • Format: “There is no [effect/difference/relationship] in [dependent variable] between [independent variable groups].”
  • Example: “There is no difference in blood pressure reduction between the new medication and the existing medication.”

4. Use Proper Symbols and Notation

In formal scientific writing, use symbols and proper notation to represent the null hypothesis.

  • Here, ?1 represents the mean blood pressure reduction for the new medication, and ?2 represents the mean blood pressure reduction for the existing medication.

Why is the null hypothesis important?

The null hypothesis is crucial as it provides a baseline for comparison and allows researchers to test the significance of their findings.

How do you state a null hypothesis?

A null hypothesis is stated as no effect or no difference, typically in the form “There is no [effect/difference] between [groups/variables].”

What is the alternative hypothesis?

The alternative hypothesis (H1) suggests that there is an effect or difference between variables, opposing the null hypothesis.

What does it mean to reject the null hypothesis?

Rejecting the null hypothesis means the data provides sufficient evidence to support the alternative hypothesis, indicating a significant effect or difference.

What is a p-value?

A p-value measures the probability that the observed data would occur if the null hypothesis were true. Low p-values indicate strong evidence against the null hypothesis.

What is a Type I error?

A Type I error occurs when the null hypothesis is incorrectly rejected, meaning a false positive result is concluded.

What is a Type II error?

A Type II error happens when the null hypothesis is incorrectly accepted, meaning a false negative result is concluded.

How do you choose a significance level (?)?

The significance level, often set at 0.05, is chosen based on the acceptable risk of making a Type I error in the context of the study.

Can the null hypothesis be proven true?

No, the null hypothesis can only be rejected or not rejected. Failing to reject it does not prove it true, only that there is not enough evidence against it.

What is the role of sample size in hypothesis testing?

Larger sample sizes increase the test’s power, reducing the risk of Type II errors and making it easier to detect a true effect.

Twitter

Text prompt

  • Instructive
  • Professional

10 Examples of Public speaking

20 Examples of Gas lighting

Information

  • Author Services

Initiatives

You are accessing a machine-readable page. In order to be human-readable, please install an RSS reader.

All articles published by MDPI are made immediately available worldwide under an open access license. No special permission is required to reuse all or part of the article published by MDPI, including figures and tables. For articles published under an open access Creative Common CC BY license, any part of the article may be reused without permission provided that the original article is clearly cited. For more information, please refer to https://www.mdpi.com/openaccess .

Feature papers represent the most advanced research with significant potential for high impact in the field. A Feature Paper should be a substantial original Article that involves several techniques or approaches, provides an outlook for future research directions and describes possible research applications.

Feature papers are submitted upon individual invitation or recommendation by the scientific editors and must receive positive feedback from the reviewers.

Editor’s Choice articles are based on recommendations by the scientific editors of MDPI journals from around the world. Editors select a small number of articles recently published in the journal that they believe will be particularly interesting to readers, or important in the respective research area. The aim is to provide a snapshot of some of the most exciting work published in the various research areas of the journal.

Original Submission Date Received: .

  • Active Journals
  • Find a Journal
  • Proceedings Series
  • For Authors
  • For Reviewers
  • For Editors
  • For Librarians
  • For Publishers
  • For Societies
  • For Conference Organizers
  • Open Access Policy
  • Institutional Open Access Program
  • Special Issues Guidelines
  • Editorial Process
  • Research and Publication Ethics
  • Article Processing Charges
  • Testimonials
  • Preprints.org
  • SciProfiles
  • Encyclopedia

cells-logo

Article Menu

examples of non null hypothesis

  • Subscribe SciFeed
  • Recommended Articles
  • Google Scholar
  • on Google Scholar
  • Table of Contents

Find support for a specific problem in the support section of our website.

Please let us know what you think of our products and services.

Visit our dedicated information section to learn more about MDPI.

JSmol Viewer

Unexpected expression and function of fcεri in immortalized breast cancer cells: a cautionary null study.

examples of non null hypothesis

1. Introduction

2. materials and methods, 2.1. cell lines, 2.2. antibodies, 2.3. chloroacetate esterase staining (cae), 2.4. immunofluorescence, 2.5. flow cytometry, 2.5.1. fcεri flow cytometry, 2.5.2. ca 2+ flux assay, 2.6. polymerase chain reaction (pcr), 2.6.1. rna extraction, 2.6.2. cdna synthesis, 2.6.4. gel electrophoresis, 2.7. immunoblotting, 2.8. il-6 elisa, 2.9. r-2 genomic data search, 3.1. cae staining, 3.2. fluorescence, fcεri in 4t1 tumors in vivo, 3.3. anti-fcεriα expression in vitro, 3.4. ca 2+ flux assay, 3.6. il-6 elisa, 3.7. r2 genomics, 4. discussion, 5. conclusions, author contributions, institutional review board statement, informed consent statement, data availability statement, acknowledgments, conflicts of interest.

  • How Common Is Breast Cancer? Breast Cancer Statistics ; American Cancer Society: Atlanta, GA, USA, 2021; Available online: https://www.cancer.org/cancer/breast-cancer/about/how-common-is-breast-cancer.html (accessed on 11 November 2021).
  • Aponte-López, A.; Fuentes-Pananá, E.M.; Cortes-Muñoz, D.; Muñoz-Cruz, S. Mast Cell, the Neglected Member of the Tumor Microenvironment: Role in Breast Cancer. J. Immunol. Res. 2018 , 2018 , 2584243-11. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Rasé, V.J.; Hayward, R.; Haughian, J.M.; Pullen, N.A. T h 17, T h 22, and Myeloid-Derived Suppressor Cell Population Dynamics and Response to IL-6 in 4T1 Mammary Carcinoma. Int. J. Mol. Sci. 2022 , 23 , 10299. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Lyons, D.O.; Plewes, M.R.; Pullen, N.A. Soluble transforming growth factor beta-1 enhances murine mast cell release of Interleukin 6 in IgE-independent and Interleukin 13 in IgE-dependent settings in vitro. PLoS ONE 2018 , 13 , e0207704. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Varanasi, S.K.; Kaech, S.M.; Bui, J.D. SnapShot: Cancer immunoediting. Cell 2022 , 185 , 4038–4038.e1. [ Google Scholar ] [ CrossRef ]
  • Ganeshan, K.; Johnston, L.K.; Bryce, P.J. TGF-β1 limits the onset of innate lung inflammation by promoting mast cell-derived IL-6. J. Immunol. 2013 , 190 , 5731–5738. [ Google Scholar ] [ CrossRef ]
  • Matsunaga, Y.; Kawasaki, H.; Terada, T. Stromal mast cells and nerve fibers in various chronic liver diseases: Relevance to hepatic fibrosis. Am. J. Gastroenterol. 1999 , 94 , 1923–1932. [ Google Scholar ] [ CrossRef ]
  • Matsunaga, Y.; Terada, T. Mast cell subpopulations in chronic inflammatory hepatobiliary diseases. Liver 2000 , 20 , 152–156. [ Google Scholar ] [ CrossRef ]
  • Mangan, P.R.; Harrington, L.E.; O’Quinn, D.B.; Helms, W.S.; Bullard, D.C.; Elson, C.O.; Hatton, R.D.; Wahl, S.M.; Schoeb, T.R.; Weaver, C.T. Transforming growth factor-beta induces development of the T(H)17 lineage. Nature 2006 , 441 , 231–234. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Bettelli, E.; Carrier, Y.; Gao, W.; Korn, T.; Strom, T.B.; Oukka, M.; Weiner, H.L.; Kuchroo, V.K. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 2006 , 441 , 235–238. [ Google Scholar ] [ CrossRef ]
  • Kirshenbaum, A.S.; Akin, C.; Wu, Y.; Rottem, M.; Goff, J.P.; Beaven, M.A.; Rao, V.K.; Metcalfe, D.D. Characterization of novel stem cell factor responsive human mast cell lines LAD 1 and 2 established from a patient with mast cell sarcoma/leukemia; activation following aggregation of FceRI or FcgRI. Leuk. Res. 2003 , 27 , 677–682. [ Google Scholar ] [ CrossRef ]
  • Haughian, J.M.; Pinto, M.P.; Harrell, J.C.; Bliesner, B.S.; Joensuu, K.M.; Dye, W.W.; Sartorius, C.A.; Tan, A.C.; Heikkilä, P.; Perou, C.M.; et al. Maintenance of hormone responsiveness in luminal breast cancers by suppression of notch. Proc. Natl. Acad. Sci. USA 2012 , 109 , 2742–2747. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Lyons, D. Regulators of Mast Cell Activation; Scholarship & Creative Works @ Digital UNC. 2023. Available online: https://digscholarship.unco.edu/dissertations/960/ (accessed on 15 April 2024).
  • Protocol—Cell Surface Flow Cytometry Staining Protocol. Available online: https://www.biolegend.com/fr-ch/protocols/cell-surface-flow-cytometry-staining-protocol (accessed on 15 April 2024).
  • Vita, A.A.; Pullen, N.A. Exploring the mechanism of berberine-mediated T fh cell immunosuppression. Phytomed. Int. J. Phytother. Phytopharm. 2022 , 105 , 154343. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Belitskaya-Levy. R2 Genomics Analysis and Visualization Platform [Dataset]. In Expression Data from Breast Samples of Postmenopausal Women ; 2023; Available online: https://hgserver1.amc.nl/cgi-bin/r2/main.cgi (accessed on 15 April 2024).
  • Russo. R2 Genomics Analysis and Visualization Platform [Dataset]. In Defining the Genomic Signature of the Parous Breast ; 2023; Available online: https://hgserver1.amc.nl/cgi-bin/r2/main.cgi (accessed on 15 April 2024).
  • Russo. R2 Genomics Analysis and Visualization Platform [Dataset]. In Genomic Signature of Parity in the Breast of Premenopausal Women ; 2023; Available online: https://hgserver1.amc.nl/cgi-bin/r2/main.cgi (accessed on 15 April 2024).
  • Gruvberger-Saal. R2 Genomics Analysis and Visualization Platform [Dataset]. In Clinical Associations of ESR2 (Estrogen Receptor Beta; ERÎ2) Expression across Thousands of Primary Breast Tumors ; 2022; Available online: https://hgserver1.amc.nl/cgi-bin/r2/main.cgi (accessed on 15 April 2024).
  • Brown. R2 Genomics Analysis and Visualization Platform [Dataset]. In Comprehensive Genomic Analysis Identify Novel Subtypes and Targets of Triple-Negative Breast Cancer ; 2016; Available online: https://hgserver1.amc.nl/cgi-bin/r2/main.cgi (accessed on 15 April 2024).
  • Sinn. R2 Genomics Analysis and Visualization Platform [Dataset]. In A Robust 18-Gene Predictor for Sensitivity to Endocrine Therapy for Metastatic Breast Cancer ; 2019; Available online: https://hgserver1.amc.nl/cgi-bin/r2/main.cgi (accessed on 15 April 2024).
  • Nagata, Y.; Suzuki, R. FcεRI: A Master Regulator of Mast Cell Functions. Cells 2022 , 11 , 622. [ Google Scholar ] [ CrossRef ] [ PubMed ]
  • Fonseca, J.E.; Santos, M.J.; Canhao, H.; Choi, E. Interleukin-6 as a key player in systemic inflammation and joint destruction. Autoimmun. Rev. 2009 , 8 , 538–542. [ Google Scholar ] [ CrossRef ]
  • Chaudhury, A.; Howe, P.H. The tale of transforming growth factor-beta (TGFbeta) signaling: A soigné enigma. IUBMB Life 2009 , 61 , 929–939. [ Google Scholar ] [ CrossRef ]
  • Gruber, B.L.; Marchese, M.J.; Kew, R.R. Transforming growth factor-beta 1 mediates mast cell chemotaxis. J. Immunol. 1994 , 152 , 5860–5867. [ Google Scholar ] [ CrossRef ]
  • Kyritsi, K.; Kennedy, L.; Meadows, V.; Hargrove, L.; Demieville, J.; Pham, L.; Sybenga, A.; Kundu, D.; Cerritos, K.; Meng, F.; et al. Retracted: Mast Cells Induce Ductular Reaction Mimicking Liver Injury in Mice Through Mast Cell-Derived Transforming Growth Factor Beta 1 Signaling. Hepatology 2021 , 73 , 2397–2410. [ Google Scholar ] [ CrossRef ]
  • Helby, J.; Bojesen, S.E.; Nielsen, S.F.; Nordestgaard, B.G. IgE and risk of cancer in 37 747 individuals from the general population. Ann. Oncol. Off. J. Eur. Soc. Med. Oncol. 2015 , 26 , 1784–1790. [ Google Scholar ] [ CrossRef ]
  • Singer, J.; Achatz-Straussberger, G.; Bentley-Lukschal, A.; Fazekas-Singer, J.; Achatz, G.; Karagiannis, S.N.; Jensen-Jarolim, E. AllergoOncology: High innate IgE levels are decisive for the survival of cancer-bearing mice. World Allergy Organ. J. 2019 , 12 , 100044. [ Google Scholar ] [ CrossRef ]
  • Zhang, H.; Guo, G.; Jianzhong, C.; Zheng, Y. Decreased Level of IgE is Associated with Breast Cancer and Allergic Diseases. Med. Sci. Monit. Int. Med. J. Exp. Clin. Res. 2016 , 22 , 587–597. [ Google Scholar ] [ CrossRef ]
  • McCraw, A.J.; Chauhan, J.; Bax, H.J.; Stavraka, C.; Osborn, G.; Grandits, M.; López-Abente, J.; Josephs, D.H.; Spicer, J.; Wagner, G.K.; et al. Insights from IgE Immune Surveillance in Allergy and Cancer for Anti-Tumour IgE Treatments. Cancers 2021 , 13 , 4460. [ Google Scholar ] [ CrossRef ]
  • Gomez, G. Current Strategies to Inhibit High Affinity FcεRI-Mediated Signaling for the Treatment of Allergic Disease. Front. Immunol. 2019 , 10 , 175. [ Google Scholar ] [ CrossRef ]
  • Ioannidis, J.P.A. Why Most Published Research Findings Are False. PLoS Med. 2005 , 2 , e124. [ Google Scholar ] [ CrossRef ]
  • Joober, R.; Schmitz, N.; Annable, L.; Boksa, P. Publication bias: What are the challenges and can they be overcome? J. Psychiatry Neurosci. JPN 2012 , 37 , 149–152. [ Google Scholar ] [ CrossRef ]

Click here to enlarge figure

Primer Name5′-3′ SequencePrimer Length
FceRIa-FACTGTACGGGCAAAGTGTGG81
FceRIa-RACTTCTCACGCGGAGCTTTT81
FceRIb-FCCTCCAGTGCACCTGACATT149
FceRIb-RATGTCCGCCATGTCTGCTTT149
FceRIg-FGCCGTGATCTTGTTCTTGCTC78
FceRIg-RGCCTTTCGGACCTGGATCTT78
Author NameTissue TypeSample Size
Belitskaya-LevyPostmenopausal Normal Breast107
RussoNulli-parous Normal Breast113
RussoFull-term Pregnancy Normal Breast109
Gruvberger-SaalPrimary Tumor Breast3207
BrownTNBC Tumor Breast198
SinnTumor Breast Metastatic1108
The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

Ashbaugh, A.M.; Lyons, D.O.; Keyser, C.M.; Pullen, N.A. Unexpected Expression and Function of FcεRI in Immortalized Breast Cancer Cells: A Cautionary Null Study. Cells 2024 , 13 , 1399. https://doi.org/10.3390/cells13161399

Ashbaugh AM, Lyons DO, Keyser CM, Pullen NA. Unexpected Expression and Function of FcεRI in Immortalized Breast Cancer Cells: A Cautionary Null Study. Cells . 2024; 13(16):1399. https://doi.org/10.3390/cells13161399

Ashbaugh, Alexandria M., David O. Lyons, Carianna M. Keyser, and Nicholas A. Pullen. 2024. "Unexpected Expression and Function of FcεRI in Immortalized Breast Cancer Cells: A Cautionary Null Study" Cells 13, no. 16: 1399. https://doi.org/10.3390/cells13161399

Article Metrics

Article access statistics, further information, mdpi initiatives, follow mdpi.

MDPI

Subscribe to receive issue release notifications and newsletters from MDPI journals

IMAGES

  1. Hypothesis In Research

    examples of non null hypothesis

  2. PPT

    examples of non null hypothesis

  3. PPT

    examples of non null hypothesis

  4. PPT

    examples of non null hypothesis

  5. Null Hypothesis and Alternative Hypothesis

    examples of non null hypothesis

  6. Difference between Null and Alternative Hypothesis

    examples of non null hypothesis

COMMENTS

  1. Null & Alternative Hypotheses

    The null and alternative hypotheses offer competing answers to your research question. When the research question asks "Does the independent variable affect the dependent variable?": The null hypothesis ( H0) answers "No, there's no effect in the population.". The alternative hypothesis ( Ha) answers "Yes, there is an effect in the ...

  2. Null and Alternative Hypotheses

    The null and alternative hypotheses are two competing claims that researchers weigh evidence for and against using a statistical test: Null hypothesis (H0): There's no effect in the population. Alternative hypothesis (HA): There's an effect in the population. The effect is usually the effect of the independent variable on the dependent ...

  3. How to Write a Null Hypothesis (5 Examples)

    Example 1: Weight of Turtles. A biologist wants to test whether or not the true mean weight of a certain species of turtles is 300 pounds. To test this, he goes out and measures the weight of a random sample of 40 turtles. Here is how to write the null and alternative hypotheses for this scenario: H0: μ = 300 (the true mean weight is equal to ...

  4. 9.1 Null and Alternative Hypotheses

    The actual test begins by considering two hypotheses.They are called the null hypothesis and the alternative hypothesis.These hypotheses contain opposing viewpoints. H 0, the —null hypothesis: a statement of no difference between sample means or proportions or no difference between a sample mean or proportion and a population mean or proportion. In other words, the difference equals 0.

  5. 10.1

    10.1 - Setting the Hypotheses: Examples. A significance test examines whether the null hypothesis provides a plausible explanation of the data. The null hypothesis itself does not involve the data. It is a statement about a parameter (a numerical characteristic of the population). These population values might be proportions or means or ...

  6. Null hypothesis and alternative hypothesis with 9 differences

    The null hypothesis is a general statement that states that there is no relationship between two phenomenons under consideration or that there is no association between two groups. An alternative hypothesis is a statement that describes that there is a relationship between two selected variables in a study. Symbol. It is denoted by H 0.

  7. 9.1: Null and Alternative Hypotheses

    Review. In a hypothesis test, sample data is evaluated in order to arrive at a decision about some type of claim.If certain conditions about the sample are satisfied, then the claim can be evaluated for a population. In a hypothesis test, we: Evaluate the null hypothesis, typically denoted with \(H_{0}\).The null is not rejected unless the hypothesis test shows otherwise.

  8. Research Hypothesis In Psychology: Types, & Examples

    Examples. A research hypothesis, in its plural form "hypotheses," is a specific, testable prediction about the anticipated results of a study, established at its outset. It is a key component of the scientific method. Hypotheses connect theory to data and guide the research process towards expanding scientific understanding.

  9. Examples of null and alternative hypotheses

    It is the opposite of your research hypothesis. The alternative hypothesis--that is, the research hypothesis--is the idea, phenomenon, observation that you want to prove. If you suspect that girls take longer to get ready for school than boys, then: Alternative: girls time > boys time. Null: girls time <= boys time.

  10. Null and Alternative Hypotheses

    The actual test begins by considering two hypotheses.They are called the null hypothesis and the alternative hypothesis.These hypotheses contain opposing viewpoints. H 0: The null hypothesis: It is a statement about the population that either is believed to be true or is used to put forth an argument unless it can be shown to be incorrect beyond a reasonable doubt.

  11. Null Hypothesis: Definition, Rejecting & Examples

    It is one of two mutually exclusive hypotheses about a population in a hypothesis test. When your sample contains sufficient evidence, you can reject the null and conclude that the effect is statistically significant. Statisticians often denote the null hypothesis as H 0 or H A. Null Hypothesis H0: No effect exists in the population.

  12. How to Formulate a Null Hypothesis (With Examples)

    To distinguish it from other hypotheses, the null hypothesis is written as H 0 (which is read as "H-nought," "H-null," or "H-zero"). A significance test is used to determine the likelihood that the results supporting the null hypothesis are not due to chance. A confidence level of 95% or 99% is common. Keep in mind, even if the confidence level is high, there is still a small chance the ...

  13. What Is The Null Hypothesis & When To Reject It

    For example, if studying the impact of exercise on weight loss, your null hypothesis might be: ... hypothesis contains the not equal sign ("≠"). However, a null hypothesis is neither directional nor non-directional. A null hypothesis is a prediction that there will be no change, relationship, or difference between two variables. ...

  14. Null hypothesis

    The null hypothesis and the alternative hypothesis are types of conjectures used in statistical tests to make statistical inferences, which are formal methods of reaching conclusions and separating scientific claims from statistical noise.. The statement being tested in a test of statistical significance is called the null hypothesis. The test of significance is designed to assess the strength ...

  15. Null Hypothesis Definition and Examples

    Null Hypothesis Examples. "Hyperactivity is unrelated to eating sugar " is an example of a null hypothesis. If the hypothesis is tested and found to be false, using statistics, then a connection between hyperactivity and sugar ingestion may be indicated. A significance test is the most common statistical test used to establish confidence in a ...

  16. Two-Tailed Hypothesis Tests: 3 Example Problems

    To test this, he can perform a one-tailed hypothesis test with the following null and alternative hypotheses: H 0 (Null Hypothesis): μ = 20 grams; H A (Alternative Hypothesis): μ ≠ 20 grams; This is an example of a two-tailed hypothesis test because the alternative hypothesis contains the not equal "≠" sign. The engineer believes that ...

  17. How to Write a Null Hypothesis (with Examples and Templates)

    Write a research null hypothesis as a statement that the studied variables have no relationship to each other, or that there's no difference between 2 groups. Write a statistical null hypothesis as a mathematical equation, such as. μ 1 = μ 2 {\displaystyle \mu _ {1}=\mu _ {2}} if you're comparing group means.

  18. Null Hypothesis Examples

    An example of the null hypothesis is that light color has no effect on plant growth. The null hypothesis (H 0) is the hypothesis that states there is no statistical difference between two sample sets. In other words, it assumes the independent variable does not have an effect on the dependent variable in a scientific experiment.

  19. Null Hypothesis

    Here, the hypothesis test formulas are given below for reference. The formula for the null hypothesis is: H 0 : p = p 0. The formula for the alternative hypothesis is: H a = p >p 0, < p 0 ≠ p 0. The formula for the test static is: Remember that, p 0 is the null hypothesis and p - hat is the sample proportion.

  20. Null Hypothesis

    Non-Inferiority Null Hypothesis. In some studies, the focus might be on demonstrating that a new treatment or method is not significantly worse than the standard or existing one. ... Null Hypothesis Examples. Example 1: A researcher claims that the average time students spend on homework is 2 hours per night.

  21. 10 Statistics Questions to Ace Your Data Science Interview

    Here is a simple example to explain this: Let's say we run an ad for a test group of 100 people and get 80 conversions. The null hypothesis is that the ad had no effect on the number of conversions. In reality, however, the ad did have a significant impact on the amount of sales.

  22. 14 Examples of a Null Hypothesis

    A null hypothesis is a prediction that there is no relationship between variables. This is an important assumption for scientific inquiry as it requires any relationships between independent and dependent variables to be proven as opposed to assumed. The following are illustrative examples of a null hypothesis.

  23. 15 Null Hypothesis Examples (2024)

    A null hypothesis is a general assertion or default position that there is no relationship or effect between two measured phenomena. It's a critical part of statistics, data analysis, and the scientific method. This concept forms the basis of testing statistical significance and allows researchers to be objective in their conclusions.

  24. Null Hypothesis

    Below are the primary purposes of the null hypothesis: 1. Baseline for Comparison. The null hypothesis provides a baseline or a default position that indicates no effect, no difference, or no relationship between variables. It is the statement that researchers aim to test against an alternative hypothesis.

  25. Cells

    The high-affinity IgE receptor, FcεRI, is typically associated with type 2 effectors such as mast cells (MC). The relatively unique expression profile of FcεRI and accumulating evidence from pre-clinical and clinical settings, such as MC interactions with tumors, have led us to study MCs as a potential therapeutic target in breast cancer. Our work identified MCs interacting with tumor cells ...