CBSE Expert
CBSE Class 12 Biology Case Study Questions PDF Download
Welcome to the comprehensive guide on CBSE Class 12 Biology Case Study Questions! In this article, we will delve into the world of Biology case studies, explore the importance of case study questions, and provide you with a PDF download that will assist you in mastering this subject. Whether you’re a student preparing for your examinations or a teacher looking to enhance your teaching materials, our detailed resource will help you excel in the realm of Biology.
Case studies are a widely used educational tool that involves the in-depth analysis of a particular situation, organism, process, or problem. In CBSE Class 12 Biology, case study questions are designed to evaluate students’ critical thinking, problem-solving abilities, and practical application of biological concepts. These questions require students to apply their theoretical knowledge to real-life scenarios, thus fostering a deeper understanding of the subject matter.
Class 12 Biology Case Study Questions
CBSE Class 12 Biology question paper will have case study questions too. These case-based questions will be objective type in nature. So, Class 12 Biology students must prepare themselves for such questions. First of all, you should study NCERT Textbooks line by line, and then you should practice as many questions as possible.
Chapter-wise Solved Case Study Questions for Class 12 Biology
Class 12 students should go through important Case Study problems for Biology before the exams. This will help them to understand the type of Case Study questions that can be asked in Grade 12 Biology examinations. Our expert faculty for standard 12 Biology have designed these questions based on the trend of questions that have been asked in last year’s exams. The solutions have been designed in a manner to help the grade 12 students understand the concepts and also easy-to-learn solutions.
Books for Class 12 Biology
Strictly as per the new term-wise syllabus for Board Examinations to be held in the academic session 2022-23 for class 12 Multiple Choice Questions based on new typologies introduced by the board- Stand-Alone MCQs, MCQs based on Assertion-Reason Case-based MCQs. Include Questions from CBSE official Question Bank released in April 2022 Answer key with Explanations What are the updates in the book: Strictly as per the Term wise syllabus for Board Examinations to be held in the academic session 2022-23. Chapter-wise -Topic-wise Multiple choice questions based on the special scheme of assessment for Board Examination for Class 12th.
Tips to Excel in CBSE Class 12 Biology Case Study Questions
Thoroughly grasp the concepts.
Before attempting case study questions, ensure you have a strong grasp of fundamental biological concepts. Familiarize yourself with topics such as genetics, ecology, human physiology, and evolution. A solid foundation will empower you to tackle complex case studies with confidence.
Practice Regularly
Practice makes perfect, and this is especially true for case study questions. Allocate time to work through a diverse range of case studies regularly. Familiarizing yourself with different scenarios will prepare you for the unpredictability of examination questions.
Collaborate and Discuss
Engaging in group discussions with fellow students or teachers can be highly beneficial. Sharing perspectives, analyzing cases together, and discussing possible solutions can broaden your understanding and offer fresh insights.
Seek Guidance from Teachers
Don’t hesitate to approach your teachers for assistance. They possess valuable experience and expertise to guide you through challenging case studies and provide valuable feedback.
Time Management
During examinations, time management is crucial. Practice solving case study questions under timed conditions to improve your efficiency and ensure you complete all questions within the allocated timeframe.
In conclusion, mastering case study questions in CBSE Class 12 Biology is essential for a holistic understanding of the subject and for excelling in examinations. By honing your analytical abilities, practicing regularly, and seeking guidance, you can conquer even the most challenging case studies. Remember that learning Biology is not just about memorizing facts but about applying knowledge to real-world situations. So, embrace the power of case studies and delve into the fascinating world of Biology.
With the provided CBSE Class 12 Biology Case Study Questions PDF, you have a valuable resource at your disposal. Practice diligently, and you’ll witness your confidence soar as you become a proficient problem solver in the realm of Biology. Good luck on your academic journey!
Leave a Comment Cancel reply
Save my name, email, and website in this browser for the next time I comment.
Download India's best Exam Preparation App Now.
Key Features
- Revision Notes
- Important Questions
- Previous Years Questions
- Case-Based Questions
- Assertion and Reason Questions
No thanks, I’m not interested!
myCBSEguide
- Class 12 Biology Case...
Class 12 Biology Case Study Questions
Table of Contents
myCBSEguide App
Download the app to get CBSE Sample Papers 2023-24, NCERT Solutions (Revised), Most Important Questions, Previous Year Question Bank, Mock Tests, and Detailed Notes.
As we know that CBSE will now ask case study questions in each subject. In most of the cases, we have noticed that these case-based questions are high-scoring. A little effort on these case study questions can help you get good marks in your board exams. You can download CBSE Class 12 Biology Case Study Questions from the myCBSEguide App or from our Student Dashboard .
Let’s understand what type of case study questions CBSE asks in class 12 Biology. If you analyze the latest class 12 Biology sample papers , you will find that there are two types of case study questions in the Biology question papers.
- Case Studies with objective questions
- Case studies with subjective questions
As per the latest circular issued by CBSE on Assessment and Evaluation Practices of the Board for the Session 2022-23 , CBSE has clearly mentioned that competency-based questions including case studies will be different from subjective questions. Hence, we expect that CBSE will ask only objective questions in CBSE class 12 Biology case study questions too.
Biology Competency Based Questions
As discussed earlier too, the competency-based questions promote learning development for our students and test higher-order skills, such as analysis, critical thinking and conceptual clarity. Case study questions are actually competency-based questions. The very purpose of including such questions in the curriculum is to emphasise on development of problem-solving ability and the ability to apply knowledge in real-life situations.
Even in CBSE Class 12 Biology case studies, you will find some text input like paragraphs, pictures, data etc followed by some objective-type questions. You should read the given information carefully and then answer the questions.
CBSE 12th Biology Case Study MCQs
Here is one example question on subjective type case study questions. This was given in the term-2 sample paper in 2022.
Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single-stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.
- What is the objective of this action?
- Explain how the gene of interest is introduced into a vector.
- You are given the DNA shown below. 5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
- A gene M was introduced into E.coli cloning vector PBR322 at the BamH1 site. What will be its impact on the recombinant plasmids? Give a possible way by which you could differentiate non-recombinant to recombinant plasmids.
Let’s take another example from MCQ type question:
To answer the questions, study the graphs below for Subject-1 and 2 showing different levels of certain hormones.
The peak observed in Subject-1 and 2 is due to
- progesterone
- luteinizing hormone
- follicle stimulating hormone
Subject 2 has higher level of hormone B, which is
If the peak of Hormone A does not appear in the study for Subject 1, which of the following statement is true?
- Peak of Hormone B will be observed at a higher point in the graph
- Peak of Hormone B will be observed at a point lower than what is given in the graph
- There will be no observed data for Hormone B
- The graph for Hormone B will be a sharp rise followed by a plateau
Which structure in the ovary will remain functional in subject 2?
- Corpus Luteum
- Tertiary follicle
- Graafian follicle
- Primary follicle
For subject 2 it is observed that the peak for hormone B has reached the plateau stage. After approximately how much time will the curve for hormone B descend?
Which of the following statements is true about the subjects?
- Subject 1 is pregnant
- Subject 2 is pregnant
- Both subject 1 and 2 are pregnant
- Both subject 1 and 2 are not pregnant
Another example of a class 12 Biology case study question
We use microbes or products which are derived from them every day. A common example is the production of curd from milk. Micro-organisms such as Lactobacillus and others commonly called lactic acid bacteria (LAB) grow in milk and convert it to curd. The dough, which is used for making foods such as dosa and idli is also fermented by bacteria. A number of traditional drinks and foods are also made by fermentation by microbes. ‘Toddy’, a traditional drink in some parts of southern India is made by fermenting sap from palms. The ‘Roquefort cheese’ is ripened by growing specific fungi on them, which gives them a particular flavour. Different varieties of cheese are known by their characteristic texture, flavour and taste, the specificity coming from the microbes used.
- Penicillium notatum
- Saccharomyces cerevisiae
- Aspergillus niger
- Clostridium butylicum
- thermal vents
- polluted water
- all of these
- None of the above
- production of a large amount of CO 2
- production of O 2
- due to the presence of water
- none of these
- Both Assertion and Reason are true and Reason is the correct explanation of the Assertion
- Both Assertion and Reason are true but Reason is not the correct explanation of the Assertion
- Our Assertion is true but the Reason is false
- Both the statements are false
Download 12 Biology Case Study Questions
In this article, we have given you a few examples of class 12 Biology case study questions. We advise you to download the myCBSEguide App or access our Student Dashboard to get more case study questions for CBSE class 12 biology. We have hundreds of questions on case studies related to CBSE Class 12 Biology. As CBSE is now focusing more on the understanding of the concepts, it is a must for students to practice such questions regularly.
Test Generator
Create question paper PDF and online tests with your own name & logo in minutes.
Question Bank, Mock Tests, Exam Papers, NCERT Solutions, Sample Papers, Notes
Related Posts
- Competency Based Learning in CBSE Schools
- Class 11 Physical Education Case Study Questions
- Class 11 Sociology Case Study Questions
- Class 12 Applied Mathematics Case Study Questions
- Class 11 Applied Mathematics Case Study Questions
- Class 11 Mathematics Case Study Questions
- Class 11 Biology Case Study Questions
- Class 12 Physical Education Case Study Questions
Leave a Comment
Save my name, email, and website in this browser for the next time I comment.
Case Study Based Questions for CBSE Class 12 Biology Board Exam 2024: Read this article for Last Minute Revision
Cbse class 12 biology important case study questions : practise important case study based questions for class 12 biology board exam. these case study based questions are important for the upcoming cbse class 12 biology board exam 2024 on march 19, 2024..
CBSE Class 12th Biology Board Exam 2023-24 Pattern
The paper will be of 70 marks and the time duration for completing the paper will be 3 hours.
The paper will have 33 questions divided into 5 sections.
Section–A 16 questions of 1 mark each,
Section–B 5 questions of 2 marks each;
Section–C 7 questions of 3 marks each;
Section–D 2 case-based questions of 4 marks each,
and Section–E 3 questions of 5 marks each.
CBSE Class 12 Biology Important Case Study Based Questions
Case Study 1: Nondisjunction is the failure of homologous chromosomes to disjoin correctly during meiosis. It leads to the formation of a new cell with an abnormal amount of genetic material. A number of clinical conditions are the result of this type of chromosomal mutation. This results in the production of gametes containing a greater or lesser chromosomal amount than normal ones. Consequently, the individual may develop a trisomy or monosomal syndrome. Nondisjunction can occur in both Meiosis I and Meiosis II of the cellular division. It is also the main cause of many genetic disorders; however, its origin and process remain vague. Although it results in the majority of cases from errors in maternal meiosis II, both paternal and maternal meiosis I do influence it. Maternal age is considered a risk factor for trisomy, as well as recombination alterations and many others that can affect chromosomal segregation.
- It is the presence of an extra chromosome in a diploid cell.
- An aneuploid cell differs from other cells only in size.
- It can be less number of chromosomes in a diploid cell.
- Aneuploidy always affects female individuals.
- both i and iii
- both ii and iii
- i, iii and iv
- Errors in meiosis I is the only cause of aneuploidy
- Aneuploidy always affects sex chromosomes.
- Most of the aneuploidy results from errors in cell division involved in egg formation.
- Nondisjunction in meiosis I can lead to more abnormal cells than disjunction in meiosis II.
- both I and iii
- both iii and iv
- I, iii and iv
- Aneuploidy is not influenced by the mother’s age.
- Delivery before 30 years of age can decrease the incidence of aneuploidy in most cases
- The chance of aneuploidy increases up to 22 years of age.
- There is a dramatic increase in aneuploidy if the maternal age exceeds 30
- both ii and iv
- Chromosomal disorders
- Mendelian disorders
- Incomplete dominance
- All the above
Q5: Assertion: All types of genetic disorders are caused by chromosomal nondisjunction.
- Both assertion and reason are correct and the reason is the correct explanation of assertion
- Both assertion and reason are correct but the reason is not the correct explanation of the assertion
- Assertion is correct but the reason is incorrect
- Both assertion and reason are incorrect
Case Study 2: A Representative Diagram of the Human Genome Project:
- Biotechnology
- Biomonitoring
- Bioinformatics
- Biosystematics
Q2: Name a free living, non-pathogenic nematode, the DNA of which has been completely sequenced.
Answer: Caenorhabditis elegans
Q3: Summarize the methodology adopted in the Human Genome Project.
Answer: Expressed Sequence Tags (ESTs) : The approach focused on identifying all the genes that are expressed as RNA.
Sequence Annotation : The other took the blind approach of simply sequencing the whole set of genome that contained all the coding and non-coding sequence, and later assigning different regions in the sequence with functions.
Q4: What are SNPs’? How are they useful in human genomics?
- Identify disease-causing genes in humans
- Can be used to understand the molecular mechanisms of sequence evolution.
Q5: Mention at least four salient features of the Human Genome Project.
- Human genome contains 3164.7 million bp.
- Average gene consists of 3000 bases, but sizes vary greatly.
- Almost all (99.9 percent) nucleotide bases are exactly the same in all people.
- Less than 2 percent of the genome codes for proteins.
Case Study 3: Two blood samples of suspects ‘A’ and ‘B’ were sent to the Forensic Department along with sample ‘C’ from the crime scene. The Forensic Department was assigned the responsibility of running the samples and matching the samples of the suspects with that of the sample from the scene of the crime and thereby identifying the culprit.
- A radioactively labelled double stranded RNA molecule.
- A radioactively labelled double stranded DNA molecule.
- A radioactively labelled single stranded DNA molecule.
- A radioactively labelled single stranded RNA molecule.
Q3: What does ‘minisatellite’ and ‘microsatellite’ mean in relation to DNA Fingerprinting?
Answer: Minisatellite: the repeating unit consists of 10-100 base pairs.
Microsatellite: the repeating unit consists of 2-6 base pairs.
Q3: How does polymorphism arise in a population?
Answer: Polymorphism (variation at the genetic level) arises due to mutations.
Q4: State the steps involved in DNA Fingerprinting in a sequential manner.
- DNA isolation
- DNA digestion with restriction enzymes.
- DNA fragment separation by electrophoresis.
- Hybridization
- DNA visualization under UV light.
Case Study 4: Bacteria like Streptococcus pneumoniae and Haemophilus influenzae are responsible for the disease pneumonia in humans which infects the alveoli (air-filled sacs) of the lungs. As a result of the infection, the alveoli get filled with fluid leading to severe problems in respiration. The symptoms of pneumonia include fever, chills, cough, and headache. In severe cases, the lips and fingernails may turn gray to bluish in colour. A healthy person acquires the infection by inhaling the droplets/aerosols released by an infected person or even by sharing glasses and utensils with an infected person. Dysentery, plague, diphtheria, etc., are some of the other bacterial diseases in man. Many viruses also cause diseases in human beings. Rhinoviruses represent one such group of viruses that cause one of the most infectious human ailments – the common cold. They infect the nose and respiratory passage but not the lungs.
The common cold is characterized by nasal congestion and discharge, sore throat, hoarseness, cough,
headache, tiredness, etc., which usually lasts for 3-7 days. Droplets resulting from the cough or sneezes of an infected person are either inhaled directly or transmitted through contaminated objects such as pens, books, cups, doorknobs, computer keyboards or mice, etc., and cause infection in a healthy person.
- By exhaling droplets of a non-infected person.
- By headache or leg pain.
- By eating fast food.
- By inhaling droplets of an infected person.
Q4: How long does the common cold last?
Answer: 3-7 days
Q5: Write any two symptoms of the common cold and pneumonia.
Answer: Cough and nasal congestion.
Case Study 5: When you insert a piece of alien DNA into a cloning vector and transfer it into a bacterial, plant, or animal cell, the alien DNA gets multiplied. In almost all recombinant technologies, the ultimate aim is to produce a desirable protein. Hence, there is a need for the recombinant DNA to be expressed. The foreign gene gets expressed under appropriate conditions. The expression of foreign genes in host cells involves understanding many technical details. After having cloned the gene of interest and having optimised the conditions to induce the expression of the target protein, one has to consider producing it on a large scale. Can you think of any reason why there is a need for large-scale production? If any protein encoding gene is expressed in a heterologous host, it is called a recombinant protein. The cells harbouring cloned genes of interest may be grown on a small scale in the laboratory. The cultures may be used for extracting the desired protein and then purifying it by using different separation techniques.
- A continuous culture system
- A stirred-tank bioreactor without in-lets and out-lets
- Laboratory flask of the largest capacity
- None of the above
- upstream processing
- downstream processing
- bioprocessing
- postproduction processing
- Human insulin
- Growth hormone
- cleaving and joining of DNA segments with endonuclease
- cleaving DNA segments with endonuclease and re-joining with ligase
- cleaving and re-joining DNA segments with ligase
- cleaving DNA segments with ligase and re-joining with endonuclease
Case Study 6: Gene Therapy
Read the following and answer the questions that follow:
- Replacing a disease-causing gene with a healthy copy of the gene
- Inactivating a disease-causing gene that is not functioning properly
- Introducing a new or modified gene into the body to help treat a disease
- Adenosine deaminase
- phenylketonuria
- Phenylalanine
- Bone marrow transplantation
- Southern blotting
Q4 Introduction of gene isolate from bone marrow producing ADA should be introduced at what age to
- acute diseases
- physiological diseases
- hereditary diseases
- infectious diseases
- CBSE Class 12 Biology Previous Year Question Papers with Solutions PDF Download
- CBSE Class 12 Syllabus 2023-24 PDF (All Subjects)
- CBSE Class 12 Deleted Syllabus (All Subjects)
- CBSE Class 12 Previous Year Papers with Solution PDF Download
- CBSE Class 12 Additional Practice Questions
- CBSE Class 12 Sample Paper 2023-24 with Solution and Additional Practice Questions
- Important MCQs for CBSE Class 12 Biology, All Chapters
- CBSE Class 12 Biology Mind Maps for Quick Revision
- CBSE Class 12 NCERT Biology Revised Textbook PDF
- CBSE Class 12 NCERT Biology Solutions
- CBSE Class 12 Biology Chapter-wise notes
- CBSE Class 12 Date Sheet 2024
- CBSE Competency Based Questions 2023-24
- CBSE Class 12 Additional Practice Questions 2024
Get here latest School , CBSE and Govt Jobs notification and articles in English and Hindi for Sarkari Naukari , Sarkari Result and Exam Preparation . Download the Jagran Josh Sarkari Naukri App .
- CBSE Board exam 2023 result date. + As per the guidelines released by the Central Board of Secondary Education (CBSE), the tentative dates for the CBSE Board Exam 2023 results are; for class 10th: 15th April 2023 and for class 12th: 30th April 2023.
- When is the Class 12th Biology CBSE Board exam? + According to the date sheet released by the Central Board of Secondary Education (CBSE) for class 12th, the Biology exam is scheduled for the 16th of March 2023. The day will be Thursday.
- UP Police Answer Key 2024
- RRB NTPC Syllabus 2024
- RBI Grade B Admit Card 2024
- SSC GD Recruitment 2025
- SSC CGL Admit Card 2024
- UP Police Constable Question Paper 2024 PDF
- CDS Question Paper 2024
- Hindi Diwas Speech
- Hindi Diwas Kavita
- Hindi Diwas Slogans, Thoughts
- Education News
- CBSE Class 10
Latest Education News
Good News for Rail Passengers: Government Set to Launch Super App for Seamless Railway Services
Picture Puzzle Test: Only the Top 3% With Great IQ can Spot These Five Lemons In 20 Seconds
हरियाणा का सबसे कम पढ़ा-लिखा जिला कौन-सा है, जानें
RRB ALP Syllabus 2024: PDF Download For Assistant Loco Pilot CBT 1 and 2, Exam Pattern
Word Search Puzzle: Only puzzle champions can spot the word “boys” in 8 seconds!
IBPS PO Mock Test 2024: Practice Online Quiz, Test Series in English and Hindi
Optical Illusion: The animal you see first reveals whether you are analytical or creative
RRC NCR Apprentice Recruitment 2024 Notification: Apply Online for 1679 Vacancies at rrcpryj.org
Historic Moment for Pakistan: PCB Welcomes Its First International Female Umpire
Indian Navy SSR 2024: इंडियन नेवी में निकली भर्ती यहाँ देखें पात्रता और आवेदन प्रक्रिया
UP Police Constable Answer Key 2024 OUT at uppbpb.gov.in: Download UPPRPB Question Paper and Submit Objection
Narendra Modi Birthday: 11 Key Decisions Taken in India Under PM Modi Government
Current Affairs Quiz In Hindi 13 Sept 2024: अखिल भारतीय राजभाषा सम्मेलन 2024
KSEAB 10th SA 1 Date Sheet 2024-25: Karnataka Board Class 10 Exam Schedule PDF
RRB NTPC Notification 2024 OUT at rrbapply.gov.in, Online Application for 8113 Graduate Posts Before 13 October
Picture Puzzle IQ Test: Can you spot the mistake in the picture in 5 seconds?
CBSE Class 10 Banking and Insurance Model Paper 2024-25 with Marking Scheme, Download in PDF
Today Current Affairs One Liners 16 September 2024: World Ozone Day 2024
Current Affairs Quiz 16 September 2024: PM Modi flags off India’s first Namo Bharat Rapid Rail
NPCIL Recruitment 2024: Apply Online for 70 Trade, Diploma and Graduate Apprentice Posts, Check Eligibility
- New QB365-SLMS
- 12th Standard Materials
- 11th Standard Materials
- 10th Standard Materials
- 9th Standard Materials
- 8th Standard Materials
- 7th Standard Materials
- 6th Standard Materials
- 12th Standard CBSE Materials
- 11th Standard CBSE Materials
- 10th Standard CBSE Materials
- 9th Standard CBSE Materials
- 8th Standard CBSE Materials
- 7th Standard CBSE Materials
- 6th Standard CBSE Materials
- Tamilnadu Stateboard
- Scholarship Exams
- Scholarships
CBSE 12th Standard Biology Subject Evolution Case Study Questions With Solution 2021
By QB365 on 21 May, 2021
QB365 Provides the updated CASE Study Questions for Class 12 Biology, and also provide the detail solution for each and every case study questions . Case study questions are latest updated question pattern from NCERT, QB365 will helps to get more marks in Exams
QB365 - Question Bank Software
12th Standard CBSE
Final Semester - June 2015
Case Study Questions
In 1950s, there were hardly any mosquitoes in Delhi. The use of the pesticide, DDT on standing water killed their larvae. But, now there are mosquitoes because they have evolved DDT-resistance through the interaction of mutation and Natural selection. State in a sequences, how that could have happened.
When the reptiles came down, mammals took over the earth. There were mammals in South America, which resembled some of the modern day mammals. But due to continental drift, they disappeared whereas the pouched mammals of Australia flourished and evolved into the various forms of pouched mammals that we see today. (a) Mention two characteristic features that were the reasons for the successful existence of mammals on earth. (b) Why did the continental drift affect the mammals of South America and Australia, differently.
According to Hardy-Weinberg principle, the allele frequencies in a population are stable and remain constant through generations. When the frequency differs from the expected values, the difference indicates the extent (direction) of evolutionary change. Disturbance in the genetic equilibrium or Hardy-Weinberg equilibrium in a population can be interpreted as resulting in evolution. (a) Write the algebraic equation representing Hardy-Weinberg equilibrium. (b) List the five factors that affect the genetic equilibrium.
*****************************************
Cbse 12th standard biology subject evolution case study questions with solution 2021 answer keys.
(a) S.L. Miller tried to prove the hypothesis of Oparin and Haldane; it is as follows: (i) The first from oflife could have come from the pre-existing non-living organic molecules like RNA, proteins, etc. (ii) Formation oflife was preceded by chemical evolution that resulted in the formation of diverse organic molecules from inorganic constituents. (b) Amino acids. (c) Hydrogen is missing.
(a) Divergent evolution. (b) Homologous organs. (c) Homology indicates common ancestry.
(i) There were some larvae with a mutated gene that conferred resistance to DDT. (ii) The DDT-resistant larvae survived while the others died. (iii) The DDT-resistant larvae reached adulthood and reproduced in large numbers. (iv) The progeny also consisted mostly ofDDT-resistant larvae. (v) Natural selection operating over a number of generations, favoured the DDT-resistant mosquitoes to reproduce in large numbers. (vi) Hence, today there is a large number of mosquitoes that are resistant to DDT.
(a) (i) Most of the mammals were viviparous and protected their unborn young ones inside the mother's body. (ii) With increased brain size, they became intelligent in sensing and avoiding danger. (b) (i) Due to continental drift, when South America joined North America, the South American mammals were overridden by those of North America. (ii) But Australia became separated and due to lack of competition from any other mammal, the pouched mammals flourished and evolved.
(a) (p + q) 2 or p 2 + 2pq + q 2 = I. (b) The factors include: (i) Gene migration/gene flow (ii) Genetic drift (iii) Mutation (iv) Genetic recombination (v) Natural selection .
Related 12th Standard CBSE Biology Materials
12th standard cbse syllabus & materials, cbse 12th physics wave optics chapter case study question with answers, cbse 12th physics ray optics and optical instruments chapter case study question with answers, cbse 12th physics nuclei chapter case study question with answers, cbse 12th physics moving charges and magnetism chapter case study question with answers, cbse 12th physics electromagnetic induction chapter case study question with answers, cbse 12th physics atoms chapter case study question with answers, 12th physics alternating current chapter case study question with answers cbse, 12th maths vector algebra chapter case study question with answers cbse, 12th maths three dimensional geometry chapter case study question with answers cbse, 12th maths probability chapter case study question with answers cbse, 12th maths linear programming chapter case study question with answers cbse, 12th maths differential equations chapter case study question with answers cbse, 12th maths continuity and differentiability chapter case study question with answers cbse, 12th maths application of integrals chapter case study question with answers cbse, 12th chemistry the d and f block elements chapter case study question with answers cbse.
Class VI to XII
Tn state board / cbse, 3000+ q&a's per subject, score high marks.
12th Standard CBSE Study Materials
12th Standard CBSE Subjects
- Andhra Pradesh
- Chhattisgarh
- West Bengal
- Madhya Pradesh
- Maharashtra
- Jammu & Kashmir
- NCERT Books 2022-23
- NCERT Solutions
- NCERT Notes
- NCERT Exemplar Books
- NCERT Exemplar Solution
- States UT Book
- School Kits & Lab Manual
- NCERT Books 2021-22
- NCERT Books 2020-21
- NCERT Book 2019-2020
- NCERT Book 2015-2016
- RD Sharma Solution
- TS Grewal Solution
- TR Jain Solution
- Selina Solution
- Frank Solution
- Lakhmir Singh and Manjit Kaur Solution
- I.E.Irodov solutions
- ICSE - Goyal Brothers Park
- ICSE - Dorothy M. Noronhe
- Micheal Vaz Solution
- S.S. Krotov Solution
- Evergreen Science
- KC Sinha Solution
- ICSE - ISC Jayanti Sengupta, Oxford
- ICSE Focus on History
- ICSE GeoGraphy Voyage
- ICSE Hindi Solution
- ICSE Treasure Trove Solution
- Thomas & Finney Solution
- SL Loney Solution
- SB Mathur Solution
- P Bahadur Solution
- Narendra Awasthi Solution
- MS Chauhan Solution
- LA Sena Solution
- Integral Calculus Amit Agarwal Solution
- IA Maron Solution
- Hall & Knight Solution
- Errorless Solution
- Pradeep's KL Gogia Solution
- OP Tandon Solutions
- Sample Papers
- Previous Year Question Paper
- Important Question
- Value Based Questions
- CBSE Syllabus
- CBSE MCQs PDF
- Assertion & Reason
- New Revision Notes
- Revision Notes
- Question Bank
- Marks Wise Question
- Toppers Answer Sheets
- Exam Paper Aalysis
- Concept Map
- CBSE Text Book
- Additional Practice Questions
- Vocational Book
- CBSE - Concept
- KVS NCERT CBSE Worksheets
- Formula Class Wise
- Formula Chapter Wise
- Toppers Notes
- Most Repeated Question
- Diagram Based Question
- Study Planner
- JEE Previous Year Paper
- JEE Mock Test
- JEE Crash Course
- JEE Sample Papers
- Important Info
- SRM-JEEE Previous Year Paper
- SRM-JEEE Mock Test
- VITEEE Previous Year Paper
- VITEEE Mock Test
- BITSAT Previous Year Paper
- BITSAT Mock Test
- Manipal Previous Year Paper
- Manipal Engineering Mock Test
- AP EAMCET Previous Year Paper
- AP EAMCET Mock Test
- COMEDK Previous Year Paper
- COMEDK Mock Test
- GUJCET Previous Year Paper
- GUJCET Mock Test
- KCET Previous Year Paper
- KCET Mock Test
- KEAM Previous Year Paper
- KEAM Mock Test
- MHT CET Previous Year Paper
- MHT CET Mock Test
- TS EAMCET Previous Year Paper
- TS EAMCET Mock Test
- WBJEE Previous Year Paper
- WBJEE Mock Test
- AMU Previous Year Paper
- AMU Mock Test
- CUSAT Previous Year Paper
- CUSAT Mock Test
- AEEE Previous Year Paper
- AEEE Mock Test
- UPSEE Previous Year Paper
- UPSEE Mock Test
- CGPET Previous Year Paper
- BCECE Previous Year Paper
- JCECE Previous Year Paper
- Crash Course
- Previous Year Paper
- NCERT Based Short Notes
- NCERT Based Tests
- NEET Sample Paper
- Previous Year Papers
- Quantitative Aptitude
- Numerical Aptitude Data Interpretation
- General Knowledge
- Mathematics
- Agriculture
- Accountancy
- Business Studies
- Political science
- Enviromental Studies
- Mass Media Communication
- Teaching Aptitude
- Verbal Ability & Reading Comprehension
- Logical Reasoning & Data Interpretation
- CAT Mock Test
- CAT Important Question
- CAT Vocabulary
- CAT English Grammar
- MBA General Knowledge
- CAT Mind Map
- CAT Study Planner
- CMAT Mock Test
- SRCC GBO Mock Test
- SRCC GBO PYQs
- XAT Mock Test
- SNAP Mock Test
- IIFT Mock Test
- MAT Mock Test
- CUET PG Mock Test
- CUET PG PYQs
- MAH CET Mock Test
- MAH CET PYQs
- NAVODAYA VIDYALAYA
- SAINIK SCHOOL (AISSEE)
- Mechanical Engineering
- Electrical Engineering
- Electronics & Communication Engineering
- Civil Engineering
- Computer Science Engineering
- CBSE Board News
- Scholarship Olympiad
- School Admissions
- Entrance Exams
- All Board Updates
- Miscellaneous
- State Wise Books
- Engineering Exam
Biology Case Study for Class 12 (Download Free PDF)
Free pdf download.
SHARING IS CARING If our Website helped you a little, then kindly spread our voice using Social Networks. Spread our word to your readers, friends, teachers, students & all those close ones who deserve to know what you know now.
Biology Case Study for Class 12
While preparing for the board exams, students are being judged on different levels of skills, such as writing, reading, etc. Biology Case Study for Class 12 questions are one of them that helps in assessing critical thinking.
The Central Board of Secondary Education will be asking the case study questions in the Class 12 board examination. Therefore, here on this page, we have provided the Biology Case Study for Class 12 at free of cost. Our subject matter experts have prepared Case Study questions so that Apart from the basic standard questions, students can have a variety of problems to solve.
Just like MCQs, and other written types questions Biology Case Study for Class 12 questions will impact the overall performance of a student. Therefore for the convenience of the students we have provided the download links here, so that they can easily access the Class 12 Case Study.
Download Chapter Wise Biology Case Study for Class 12 Question and Answers PDF
There are lots of chapters in class 12 Biology from which Class 12 Case Study Questions can be framed. Going through such types of questions help the students to assess their understanding level in the topics discussed in NCERT Class 12 Biology Books. By practicing the Class 12 Case Study Questions for Biology students will be very confident to ace the board exam. Also the Biology case study will be very useful for the NEET exam preparation.
Doing a regular practice of Class 12 Biology Case Study questions is a great way to score higher marks in the board exams as it will help students to develop a grip on the concepts.
Here our subject experts have crafted the Subject Wise Case Study For Class 12. Download Subject Wise CBSE Case Study Class 12 Question and Answers PDF from the below given links.
Case Study Questions Class 12 Chapter 2 Sexual Reproduction in Flowering Plants
Case Study Questions Class 12 Chapter 3 Human Reproduction
Case Study Questions Class 12 Chapter 4 Reproductive Health
Case Study Questions Class 12 Chapter 5 Principles of Inheritance & Variation
Case Study Questions Class 12 Chapter 6 Molecular Basic of Inheritance
Case Study Questions Class 12 Chapter 7 Ecosystem
Case Study Questions Class 12 Chapter Evolution
Case Study Questions Class 12 Chapter 8 Human Health And Diseases
Case Study Questions Class 12 Chapter 10 Microbes in Human Welfare
Case Study Questions Class 12 Chapter 11 Biotechnology - Principles & Processes
Case Study Questions Class 12 Chapter 12 Biotechnology And Its Applications
Case Study Questions Class 12 Chapter 13 Organisms And Populations
Case Study Questions Class 12 Chapter 15 Biodiversity And Conversation
Case study types of questions are generally descriptive that helps to gather more information easily so, it is kinda easy to answer. However, our subject matter experts have given the solutions of all the Biology Case Study for Class 12 Biology questions.
Passage Based Class 12 Biology Case Study Questions in PDF
CBSE Class 12 Case studies are known as Passage Based Questions. These types of problems usually contain a short/long paragraph with 4 to 5 questions.
Students can easily solve Passage Based Class 12 Case Study Questions by reading those passages. By reading the passage students will get the exact idea of what should be the answers. Because the passage already contains some vital information or data. However a better understanding of the basic concepts that can be learned from the NCERT Class 12 Textbooks will aid in solving the Case based questions or passage based questions.
How to Download CBSE Case Study of Class 12 Biology ?
Follow the below given simple steps to know how to download CBSE Case Study of Class 12 Biology:-
- Open Selfstudys website in your browser
- Go to the navigation menu that look like this
- Now, click on CBSE and then Case Study respectively
- A new page will open, where you have to click on “Class 12”
- Now, you are ready to select the subject for which you want to download the case study questions.
How to Solve Biology Case Study Based Questions of Class 12?
There are very simple methods that a student should keep in mind while solving Biology Case Study for Class 12 for any subject:
- Read each line of paragraph carefully and pay attention to the given data/numbers. Often questions are framed according to the highlighted data of the passage.
- Since case study questions are often framed in Multiple choice questions, students should have the knowledge of elimination methods in MCQs.
- Having a good understanding of the topics that are discussed in CBSE Class 12 Books are ideal to Solve Case Study Based Questions of Class 12.
Features Of Class 12 Biology Case Study Questions And Answers PDF
The three most noticeable features of Class 12 Biology Case Study Questions And Answers Pdf are -
- It Is Free To Use: Keeping in mind the need of students and to help them in doing Self Study, our team has made all the PDF of Biology Case Study for Class 12 free of cost.
- Answers Are Given: Not only the PDFs are free provided but answers are given for all the questions of Biology Case Study for Class 12.
- PDF Can Be Downloaded Or Viewed Online: Many students don’t like to download the PDFs on their device due to the shortage of storage. Therefore, CBSE Class 12 Case Study questions are made available here in online format, so that students can view them online. However, through the Selfstudys app, a learner can download the PDFs too.
Benefits of Using CBSE Class 12 Biology Case Study Questions and Answers
The CBSE Class 12 Biology Case Study Questions and Answers can help a student in several ways:
- In Exam Preparation: Those who go through the Biology Case Study for Class 12 will find support during the exam preparation as case based questions are also asked in the CBSE Class 12 Board examination.
- Help in brushing up the previous learnings: No matter how brilliant you are, you have to revise the studied topics time and again to keep them refreshed. And in this task, the CBSE Class 12 Case Study Questions and Answers can help a lot.
- To develop the critical thinking: Able to analyse information and make an objective judgement is a skill that is known as critical thinking. A student of class 12 can use Biology Case Study for Class 12 with answers to develop critical thinking so that they can make better decisions in their life and in the board examination.
- NCERT Solutions for Class 12 Maths
- NCERT Solutions for Class 10 Maths
- CBSE Syllabus 2023-24
- Social Media Channels
- Login Customize Your Notification Preferences
- Second click on the toggle icon
Provide prime members with unlimited access to all study materials in PDF format.
Allow prime members to attempt MCQ tests multiple times to enhance their learning and understanding.
Provide prime users with access to exclusive PDF study materials that are not available to regular users.
Class 12 Biology Case Study Questions Chapter 1 The Living World
- Post author: studyrate
- Post published:
- Post category: Class 12
- Post comments: 0 Comments
In Class 12 Boards there will be Case studies and Passage Based Questions will be asked, So practice these types of questions. Study Rate is always there to help you. Free PDF Download of CBSE Class 12 Biology Chapter 1 The Living World Case Study and Passage-Based Questions with Answers were Prepared Based on the Latest Exam Pattern. Students can solve NCERT Case Study Questions The Living World to know their preparation level.
Join our Telegram Channel, there you will get various e-books for CBSE 2024 Boards exams for Class 9th, 10th, 11th, and 12th.
In CBSE Class 12 Biology Paper, There will be a few questions based on case studies and passage-based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked.
The Living World Case Study Questions With Answers
Here, we have provided case-based/passage-based questions for Class 12 Biology Chapter 1 The Living World
Case Study/Passage-Based Questions
Case Study 1: There are millions of plants and animals in the world and they are known by their local names in their area. The local names do vary from place to place, even within a country. Hence, scientists have established procedures to assign a scientific name to each organism, which is acceptable to biologists all over the world.
(a) Name the system of naming organisms given by Linnaeus.
Answer: The system of naming organisms given by Linnaeus is called “binomial nomenclature.”
(b) Mention the two components in each scientific name.
Answer: The two components in each scientific name are the genus and species names.
(c) Give the scientific name of: (i) human beings (ii) wheat.
Answer: (Scientific names of the organisms: (i) Human beings: Homo sapiens (ii) Wheat: Triticum aestivum
Case Study 2: The Living World provides a fundamental understanding of the diversity of life forms on Earth. It begins by defining life and living organisms, moving on to explain the concept of biodiversity, its types, and the importance of this diversity. The chapter further introduces the hierarchal organization of life forms in the biosphere, starting from individuals and progressing to species, genus, families, and so on, up to the kingdom level. It also emphasizes the system of binomial nomenclature developed by Carl Linnaeus and the importance of classification, taxonomy, and systematics in biology. Additionally, it provides insights into herbariums, botanical gardens, zoological parks, and museums, which serve as repositories of collected plant and animal specimens.
What is Biodiversity?
A) The variety of life forms present on Earth
B) The system of naming organisms
C) The study of plant and animal specimens
D) The process of classifying organisms into various categories
Answer: A) The variety of life forms present on Earth
What does the hierarchal organization of life forms begin with?
Answer: C) Species
Who developed the system of binomial nomenclature?
A) Charles Darwin
B) Gregor Mendel
C) Carl Linnaeus
D) Jean-Baptiste Lamarck
Answer: C) Carl Linnaeus
What is the importance of classification in biology?
A) It helps in understanding the interrelationships among different groups of organisms
B) It helps in defining life
C) It helps in identifying the number of species on Earth
D) It helps in understanding the concept of biodiversity
Answer: A) It helps in understanding the interrelationships among different groups of organisms
What is the purpose of botanical gardens and zoological parks?
A) They serve as tourist attractions
B) They serve as places for scientific research
C) They serve as repositories of plant and animal specimens
D) They serve as places for breeding endangered species
Answer: C) They serve as repositories of plant and animal specimens
Hope the information shed above regarding Case Study and Passage Based Questions for Class 12 Biology Chapter 1 The Living World with Answers Pdf free download has been useful to an extent. If you have any other queries about CBSE Class 12 Biology The Living World Case Study and Passage-Based Questions with Answers, feel free to comment below so that we can revert back to us at the earliest possible. By Team Study Rate
You Might Also Like
Class 12 biology case study questions chapter 13 organisms and populations, class 12 maths: case study of chapter 10 vector algebra pdf download, class 12 physics assertion reason questions chapter 8 electromagnetic waves, leave a reply cancel reply.
Save my name, email, and website in this browser for the next time I comment.
This site uses Akismet to reduce spam. Learn how your comment data is processed .
The Topper Combo Flashcards
- Contains the Latest NCERT in just 350 flashcards.
- Colourful and Interactive
- Summarised Important reactions according to the latest PYQs of NEET(UG) and JEE
No thanks, I’m not interested!
Case Study Question for Class 12 Biology Ch. 1, 2, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16
Understudies can discover the chapter astute vital questions for course 12th Biology within the table underneath. These imperative questions incorporate questions that are regularly inquired in a long time. Moreover, arrangements are to give for these questions, with extraordinary accentuation on ease-of-study. Tap on the joins underneath to begin investigating.
Case Study Question for Class 12 Biology Ch 1 to 16
Case study 01:.
Ans: The two different DNA molecules will have compatible ends to recombine.
Ans: Restriction enzyme cuts the DNA of the vector and then ligates the gene of interest into the DNA of the vector.
If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
Ans: BamH1 site will affect tetracycline antibiotic resistance gene, hence the recombinant plasmids will lose tetracycline resistance due to inactivation of the resistance gene
Case Study 02:
Because the use of pesticides is highly reduced for Bt crop // Decrease of pesticide used is also more significant for Bt crop.
(b) Cotton Bollworms were introduced in another experimental study on the above farm lands wherein no pesticide was used. Explain what effect would a Bt and Non Bt crop have on the pest.
Case Based Questions Class 12 Biology Chapterwise
Chapter 1 | Chapter 9 | ||
Chapter 2 | Chapter 10 | ||
Chapter 3 | Chapter 11 | ||
Chapter 4 | Chapter 12 | ||
Chapter 5 | Chapter 13 | ||
Chapter 6 | Chapter 14 | ||
Chapter 7 | Chapter 15 | ||
Chapter 8 | Chapter 16 |
Leave a Reply Cancel reply
We have a strong team of experienced teachers who are here to solve all your exam preparation doubts, ncert class 6 extra questions social science – landforms and life, pseb class 6 agriculture chapter 6 farm machinery and equipment solution, dav class 5 math solution chapter 16 triangles, up scert solutions class 6 english chapter 14 – netaji chandra bose.
No products in the cart.
Mtg.in will be in maintenance mode from 7:45 AM to 9:00 AM on Wednesday, August 21, 2024. Please do not start the checkout after 7:40 am.
- Computer Science Olympiad (ICSO) Books
- English Olympiad (IEO) Books
- GK Olympiad (IGKO) Books
- Maths Olympiad (IMO) Books
- Science Olympiad (NSO) Books
- Olympiads Combo Packs
- SST Olympiad (ISSO) Books
- Hindi Olympiad (IHO) Books
- International Computer Science Olympiad (ICSO) Books
- Commerce Olympiad (ICO) Books
- NEET Champion
- NEET Previous Years Paper
- NEET Sample Paper
- NEET Crash Course
- Online Tests
- NEET Biology Books
- NEET Physics Books
- NEET Chemistry Books
- Assertion & Reason
- AIIMS Previous Years Paper
- GK & Aptitude
- JIPMER Previous Years Paper
- JEE Main Guide
- JEE PREVIOUS YEARS PAPER
- JEE Sample Papers
- JEE Crash Course
- JEE Champion
- NCERT Fingertips
- JEE Mathematics Books
- JEE Physics Books
- JEE Chemistry Books
- KCET Books – Karnataka CET
- KEAM Books – Kerala Engineering Exam
- WBJEE Books – West Bengal JEE
- BITSAT Exam Books
- MHT CET Books – Maharashtra CET
- Live Classes
- Recorded Classes
- Monthly Magazine – Single Issue
- Monthly Magazines – Subscription
- Monthly Magazine: Older Volumes
- Foundation Course Class 6
- Foundation Course Class 7
- Foundation Course Class 8
- Foundation Course Class 9
- Foundation Course Class 10
- NCERT Solutions Class 6
- NCERT Solutions Class 7
- NCERT Solutions Class 8
- NCERT Solutions Class 9
- NCERT Solutions Class 10
- NCERT Solutions Class 11
- NCERT Solutions Class 12
- CBSE Class 9 Books
- CBSE Class 10 Reference Books
- CBSE Class 10 Sample Paper Books
- CBSE Class 10 Previous Year Solved Paper Books
- CBSE Class 11 Books
- CBSE Reference Books for Class 12
- CBSE Previous Year Papers class 12 Books
- CBSE Class 12 Sample Paper Books
- Competitive Books
- Olympiad Books – Combo
- Govt. Exams
- 21 Science Crossword Puzzles
- 51 English Grammar Worksheets
- IGKO Online Test Programme
- Literature Books
- Vedic Mathematics
- Science Skill Development
- Mathematics Skill Development
- English Skill Development
- Summer Programme Combo
- Psychometric Online Test
- General ebooks
Click on the image to zoom in
Read reviews (0)
Write a review
Score More Case Study Chapter wise Practice Questions Biology Class-12
₹ 125.00 Original price was: ₹125.00. ₹ 112.50 Current price is: ₹112.50. (10% Off)
Discount offer on this book in a bundle, click to view
ScoreMore Case Study Chapter-wise Practice Questions Biology Class-12 is curated with 750+ Chapter-wise MCQs related to Case study/ Passage based and Assertion & Reason with hints and explanations based on latest pattern of CBSE (2020-2021).
60 in stock
Your security guaranteed
- Description
- Table of content
- Additional information
- Reviews (0)
MTG ScoreMore Case Study Based Sample Questions Biology Class 12 is specially designed to help students get familiar with solving these new patterns of questions. The book covers 750 + sample questions for practice with detailed explanations to each question. Practising these questions will definitely help students to get an edge in their CBSE preparations.
For the academic year 2020-21 CBSE has incorporated more Objective type/MCQ based questions which will focus on measuring critical thinking ability of students.
The new pattern of questions includes Case study based questions, Passage based questions, Assertion and Reason type questions. In Case study based/ Passage based questions, students will be expected to answer questions after reading a given paragraph or a passage. Assertion and Reason type question is just another way of checking the clarity of one’s concept.
- 1. Reproduction in Organisms*
- 2. Sexual Reproduction in Flowering Plants
- 3. Human Reproduction
- 4. Reproductive Health
- 5. Principles of Inheritance and Variation
- 6. Molecular Basis of Inheritance
- 7. Evolution*
- 8. Human Health and Diseases
- 9. Strategies for Enhancement in Food Production*
- 10. Microbes in Human Welfare
- 11. Biotechnology : Principles and Processes
- 12. Biotechnology and its Applications
- 13. Organisms and Populations
- 14. Ecosystem*
- 15. Biodiversity and its Conservation
- 16. Environmental Issues*
- *This chapter is not a part of the Board Examination 2020-21 syllabus
ISBN13 | 9789390801572 |
---|---|
Author | MTG Editorial Board |
Edition | 2020-21 |
Pages | 144 |
Classes | Class 12 |
Exams | CBSE Boards, CUET |
Subjects | Biology |
Weight | 250gm |
There are no reviews yet.
Your email address will not be published. Required fields are marked *
Your review *
Name *
Email *
Save my name, email, and website in this browser for the next time I comment.
Customers prefer to buy this combination offer...
Score More Case Study Chapter wise Practice Questions Combo-Phy,Chem, Bio,Maths Class-12
Total Price = ₹ 500.00
Combo Price = ₹ 375.00
Score More Case Study Chapter wise Practice Questions Chemistry Class-12
Score More Case Study Chapter wise Practice Questions Maths Class-12
Score More Case Study Chapter wise Practice Questions Physics Class-12
- Notifications
- Institutional Queries
Username or Email Address
Class Select Class Class 1 Class 2 Class 3 Class 4 Class 5 Class 6 Class 7 Class 8 Class 9 Class 10 Class 11 Class 12 Pre-Nursery
Phone number
Class Select Class Class 1 Class 2 Class 3 Class 4 Class 5 Class 6 Class 7 Class 8 Class 9 Class 10 Class 11 Class 12 Others Pre-Nursery
Country * Afghanistan Åland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belau Belgium Belize Benin Bermuda Bhutan Bolivia Bonaire, Saint Eustatius and Saba Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo (Brazzaville) Congo (Kinshasa) Cook Islands Costa Rica Croatia Cuba Curaçao Cyprus Czech Republic Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Eswatini Ethiopia Falkland Islands Faroe Islands Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Gambia Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and McDonald Islands Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Isle of Man Israel Italy Ivory Coast Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kuwait Kyrgyzstan Laos Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Micronesia Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russia Rwanda São Tomé and Príncipe Saint Barthélemy Saint Helena Saint Kitts and Nevis Saint Lucia Saint Martin (Dutch part) Saint Martin (French part) Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia/Sandwich Islands South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu Uganda Ukraine United Arab Emirates United Kingdom (UK) United States (US) United States (US) Minor Outlying Islands Uruguay Uzbekistan Vanuatu Vatican Venezuela Vietnam Virgin Islands (British) Virgin Islands (US) Wallis and Futuna Western Sahara Yemen Zambia Zimbabwe
Mobile number *
Email address *
Password *
Lost your password? Please enter your username or email address. You will receive a link to create a new password via email.
Username or email
Reset password
Just remembered? Log In Instead
Don’t have an account? Register with us
Gurukul of Excellence
Classes for Physics, Chemistry and Mathematics by IITians
Join our Telegram Channel for Free PDF Download
Case Study and Passage Based Questions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance
- Last modified on: 2 years ago
- Reading Time: 2 Minutes
Case Study/Passage Based Questions:
Question 1:
Given below is the diagram of a tRNA molecule.
Answer the questions based on the above diagram: (i) Why is charging of tRNA essential in translation? (ii) Where does peptide bond formation occur in a bacterial ribosome? (iii) Name the scientist who called tRNA an adaptor molecule.
Download CBSE Books
Exam Special Series:
- Sample Question Paper for CBSE Class 10 Science (for 2024)
- Sample Question Paper for CBSE Class 10 Maths (for 2024)
- CBSE Most Repeated Questions for Class 10 Science Board Exams
- CBSE Important Diagram Based Questions Class 10 Physics Board Exams
- CBSE Important Numericals Class 10 Physics Board Exams
- CBSE Practical Based Questions for Class 10 Science Board Exams
- CBSE Important “Differentiate Between” Based Questions Class 10 Social Science
- Sample Question Papers for CBSE Class 12 Physics (for 2024)
- Sample Question Papers for CBSE Class 12 Chemistry (for 2024)
- Sample Question Papers for CBSE Class 12 Maths (for 2024)
- Sample Question Papers for CBSE Class 12 Biology (for 2024)
- CBSE Important Diagrams & Graphs Asked in Board Exams Class 12 Physics
- Master Organic Conversions CBSE Class 12 Chemistry Board Exams
- CBSE Important Numericals Class 12 Physics Board Exams
- CBSE Important Definitions Class 12 Physics Board Exams
- CBSE Important Laws & Principles Class 12 Physics Board Exams
- 10 Years CBSE Class 12 Chemistry Previous Year-Wise Solved Papers (2023-2024)
- 10 Years CBSE Class 12 Physics Previous Year-Wise Solved Papers (2023-2024)
- 10 Years CBSE Class 12 Maths Previous Year-Wise Solved Papers (2023-2024)
- 10 Years CBSE Class 12 Biology Previous Year-Wise Solved Papers (2023-2024)
- ICSE Important Numericals Class 10 Physics BOARD Exams (215 Numericals)
- ICSE Important Figure Based Questions Class 10 Physics BOARD Exams (230 Questions)
- ICSE Mole Concept and Stoichiometry Numericals Class 10 Chemistry (65 Numericals)
- ICSE Reasoning Based Questions Class 10 Chemistry BOARD Exams (150 Qs)
- ICSE Important Functions and Locations Based Questions Class 10 Biology
- ICSE Reasoning Based Questions Class 10 Biology BOARD Exams (100 Qs)
✨ Join our Online NEET Test Series for 499/- Only for 1 Year
Leave a Reply Cancel reply
Editable Study Materials for Your Institute - CBSE, ICSE, State Boards (Maharashtra & Karnataka), JEE, NEET, FOUNDATION, OLYMPIADS, PPTs
Discover more from Gurukul of Excellence
Subscribe now to keep reading and get access to the full archive.
Type your email…
Continue reading
COMMENTS
Class 12 Biology Case Study Based Questions PDF Download. We have provided here Case Study questions for the Class 12 Biology Boards exams. You can read these chapter-wise Case Study questions for your term 2 science paper. These questions are prepared by subject experts and experienced teachers. Answer key is also provided so that you can check the correct answer for each question.
Case studies are a widely used educational tool that involves the in-depth analysis of a particular situation, organism, process, or problem. In CBSE Class 12 Biology, case study questions are designed to evaluate students' critical thinking, problem-solving abilities, and practical application of biological concepts.
CBSE 12th Biology Case Study MCQs. Here is one example question on subjective type case study questions. This was given in the term-2 sample paper in 2022. Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single-stranded DNA.
CBSE Class 12 Biology Important Case Study based Questions 2024: The CBSE Board exam for class 12 Biology has been scheduled for March 19th, 2024.Class 12 Biology exam will have different types of ...
Case Study Questions Biology Class 12 PDF Chapter Wise. Class 12 Biology Case Study Questions Chapter Wise can be a great help in board exam preparations. Since students feel very overwhelmed while preparing for the examination, it will help them in doing that. Furthermore, finding many MCQs is a challenging task for the practice purpose.
QB365 Provides the updated CASE Study Questions for Class 12 Biology, and also provide the detail solution for each and every case study questions . Case study questions are latest updated question pattern from NCERT, QB365 will helps to get more marks in Exams +91 86828 95000. [email protected].
CBSE Case Study Questions Class 12 Biology Human Health and Disease Case Study 1: Our mind and mental state can affect our health. Of course, health is affected by- (i) genetic disorders - deficiencies with which a child is born and deficiencies/defects which the child inherits from parents from birth; (ii) infections and (iii) life style ...
QB365 Provides the updated CASE Study Questions for Class 12 Biology, and also provide the detail solution for each and every case study questions . Case study questions are latest updated question pattern from NCERT, QB365 will helps to get more marks in Exams +91 86828 95000. [email protected].
Here, we have provided case-based/passage-based questions for Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants. Case Study/Passage-Based Questions. Case Sudy 1: In angiosperms, the pollen grains are transferred from the anther to the stigma which is termed pollination. This phenomenon was first discovered by Camerarius (1694 ...
CBSE will ask two Case Study Questions in the CBSE class 12 Biology questions paper. Question numbers 15 and 16 are case-based questions where 5 MCQs will be asked based on a paragraph. Each theme will have five questions and students will have a choice to attempt any four of them. 2. Sexual Reproduction in Flowering Plants. 3. Human Reproduction.
Here, we have provided case-based/passage-based questions for Class 12 Biology Chapter 5 Principles of Inheritance and Variation. Case Study/Passage-Based Questions. Case Study 1: During a study on the inheritance of two genes, the teacher asked students to perform an experiment. The students crossed white-eyed, yellow-bodied female Drosophila ...
Get Sample Paper with solutions for CBSE Class 12-science Biology Case Study Questions for CBSE Class 12 Biology at TopperLearning. Sign up today & prepare for your exam with TopperLearning study materials.
Case Study Questions for Class 12 Biology Chapter 8 Human Health and Diseases. Question 1: In a study to test a new vaccine against a viral disease, mouse model testing is done. In this process, mice are vaccinated and their blood samples were tested. Mice developed mild disease symptom. After few days those mice were again infected with the virus.
CBSE Case Study Questions Class 12 Biology Ecosystem. Case study 1. Interaction of biotic and abiotic components result in a physical structure that is characteristic for each type of ecosystem. Identification and enumeration of plant and animal species of an ecosystem gives its species composition. Vertical distribution of different species ...
In CBSE Class 12 Biology Paper, Students will have to answer some questions based on Assertion and Reason. There will be a few questions based on case studies and passage based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked. Here, we have provided case … Continue reading Case Study and Passage Based Questions for Class 12 Biology Chapter 3 ...
The three most noticeable features of Class 12 Biology Case Study Questions And Answers Pdf are -. It Is Free To Use: Keeping in mind the need of students and to help them in doing Self Study, our team has made all the PDF of Biology Case Study for Class 12 free of cost. Answers Are Given: Not only the PDFs are free provided but answers are ...
CBSE Case Study Questions Class 12 Biology Organisms and Populations. Case study 1. What are the key elements that lead to so much variation in the physical and chemical conditions of different habitats? The most important ones are temperature, water, light and soil. We must remember that the physico-chemical (abiotic) components alone do not ...
In Class 12 Boards there will be Case studies and Passage Based Questions will be asked, So practice these types of questions. Study Rate is always there to help you. Free PDF Download of CBSE Class 12 Biology Chapter 1 The Living World Case Study and Passage-Based Questions with Answers were Prepared Based on the Latest Exam Pattern.
Case Study Questions for Class 12 Biology Chapter 12 Biotechnology and Its Applications. Question 1: Transgenic cows have extra gene or genes inserted into their DNA. Firstly the genes for the desired product is identified and sequenced. Then a gene construct containing this desired gene is introduced into female cow cells.
Case Study Question for Class 12 Biology Ch 1 to 16 Case Study 01: Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5'-GGATCC- 3'and ...
Paper Book. ScoreMore Case Study Chapter-wise Practice Questions Biology Class-12 is curated with 750+ Chapter-wise MCQs related to Case study/ Passage based and Assertion & Reason with hints and explanations based on latest pattern of CBSE (2020-2021). MTG ScoreMore Case Study Based Sample Questions Biology Class 12 is specially designed to ...
Hello Baccho, Here is SAHILL SIDDIQUE, Biology Educator."Give Me Board and Marker, I will make you fall in Love with Biology"
Case Study/Passage Based Questions: Question 1: Study the flowchart given below and answer the questions that follow. (i) What is a mutagen? Name a physical factor that can be mutagen.(ii) What is point mutation? Give one example.(iii) Mention two causes of frame-shift mutation. Answer Ans. (i) All the physical and chemical factors that induce mutation … Continue reading Case Study and ...
Case Study/Passage Based Questions: Question 1: Given below is the diagram of a tRNA molecule. Answer the questions based on the above diagram:(i) Why is charging of tRNA essential in translation?(ii) Where does peptide bond formation occur in a bacterial ribosome?(iii) Name the scientist who called tRNA an adaptor molecule. Answer Ans. (i) Charging of … Continue reading Case Study and ...